ECM33/YBR078W Locus History Help


Nomenclature History
Standard Name Reference
ECM33 Lussier M, et al.  (1997) Large scale identification of genes involved in cell surface biosynthesis and architecture in Saccharomyces cerevisiae. Genetics 147(2):435-50
Sequence Annotation Notes
DateNote
2011-02-03One nucleotide was inserted within ORF ECM33/YBR078W, very near its 3' end, altering its coding sequence. The start, stop, and vast majority of reading frame remain the same, but the C-terminus is different and the annotated protein sequence is now 39 amino acids shorter.
New    394715  TGCTGCTGTTGGCGTTGCCTTACTATAAGATTAAAGCAACAATTTGTGTTTCTATTATTA  394774
               |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Old    394710  TGCTGCTGTTGGCGTTGC-TTACTATAAGATTAAAGCAACAATTTGTGTTTCTATTATTA  394768
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
2011-02-03Several nucleotide changes were made in the intergenic region between ORFs SLM4/YBR077C and ECM33/YBR078W.
New    392327  GATAACTGCCTTTTTTTTTT--CTTCTTATCTTCCCTTAATTAATTCATTAGAGTCTTTT  392384
               ||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||
Old    392321  GATAACTGCCTTTTTTTTTTTTCTTCTTATCTTCCCTTAATTAATTCATTAGAGTCTTTT  392380
New    392545  CACGACCCGGGTGGCTGCTGCGCCCTCGCGAAAAAGAAATGAAATGGAGTGCAAAAACGG  392604
               ||||||||||||||||  |||||||||  |||||||||||||||||||||||||||||||
Old    392541  CACGACCCGGGTGGCTCGTGCGCCCTCCGGAAAAAGAAATGAAATGGAGTGCAAAAACGG  392600
New    392805  AATGTCAAACACCTACGACTTTTCGCAATCAACGGACCTCTCTTGCATTTTTGTATTTAA  392864
               |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Old    392801  AATGTCAAACACCTACGACTTT-CGCAATCAACGGACCTCTCTTGCATTTTTGTATTTAA  392859
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()