RDH54/YBR073W Locus History Help


Nomenclature History
Standard Name Reference
RDH54 Klein HL  (1997) RDH54, a RAD54 homologue in Saccharomyces cerevisiae, is required for mitotic diploid-specific recombination and repair and for meiosis. Genetics 147(4):1533-43
Other Name(s)Reference
TID1 Dresser ME, et al.  (1997) DMC1 functions in a Saccharomyces cerevisiae meiotic pathway that is largely independent of the RAD51 pathway. Genetics 147(2):533-44
Sequence Annotation Notes
DateNote
2003-09-22The start site for RDH54/YBR073W was moved 102 nt (34 codons) downstream based on the automated comparison of closely-related Saccharomyces species. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al.  (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
Cliften P, et al.  (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2009-05-07The start site for RDH54/YBR073W was reinstated 102 nt (34 codons) upstream. This is a reversal of the start site change made to this ORF on 2003-09-22. Thank you to Nancy Hollingsworth for bringing this issue to our attention.

Shinohara M, et al.  (1997) Characterization of the roles of the Saccharomyces cerevisiae RAD54 gene and a homologue of RAD54, RDH54/TID1, in mitosis and meiosis. Genetics 147(4):1545-56
Petukhova G, et al.  (2000) Promotion of Rad51-dependent D-loop formation by yeast recombination factor Rdh54/Tid1. Genes Dev 14(17):2206-15
Chi P, et al.  (2006) Yeast recombination factor Rdh54 functionally interacts with the Rad51 recombinase and catalyzes Rad51 removal from DNA. J Biol Chem 281(36):26268-79
Kwon Y, et al.  (2008) ATP-dependent Chromatin Remodeling by the Saccharomyces cerevisiae Homologous Recombination Factor Rdh54. J Biol Chem 283(16):10445-52
2011-02-03Nucleotide substitutions within the coding region of RDH54/YBR073W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 752 is now Alanine rather than Arginine.
New    385318  TCTTGTTGAGTGCAAAATCGGGAGGTGTAGGATTGAATCTAGTCGGTGCTTCGCGACTTA  385377
               |||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||
Old    385313  TCTTGTTGAGTGCAAAATCGGGAGGTGTAGGATTGAATCTAGTCGGTCGTTCGCGACTTA  385367
Dietrich F  (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. ()