HSP26/YBR072W Locus History Help


Nomenclature History
Standard Name Reference
HSP26 Bossier P, et al.  (1989) Structure and expression of a yeast gene encoding the small heat-shock protein Hsp26. Gene 78(2):323-30 Petko L and Lindquist S  (1986) Hsp26 is not required for growth at high temperatures, nor for thermotolerance, spore development, or germination. Cell 45(6):885-94
Sequence Annotation Notes
DateNote
2011-02-03Two separate single nucleotide insertions were made in the intergenic region between ORFs HSP26/YBR072W and YBR072C-A.
New    382719  TTGCTTGCATATGGGCTTGAAACATATGGTCATCACATCTGAGCGATTTTACCTCTTAGA  382778
               |||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||
Old    382716  TTGCTTGCATATGG-CTTGAAACATATG-TCATCACATCTGAGCGATTTTACCTCTTAGA  382773
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()