FAT1/YBR041W Locus History Help


Nomenclature History
Standard Name Reference
FAT1 Faergeman NJ, et al.  (1997) Disruption of the Saccharomyces cerevisiae homologue to the murine fatty acid transport protein impairs uptake and growth on long-chain fatty acids. J Biol Chem 272(13):8531-8
Sequence Annotation Notes
DateNote
2004-01-21Kellis et al. 2003 and Brachat et al. 2003 independently predicted and confirmed the deletion of two C nucleotides from YBR041W. As a consequence of this change, YBR041W was extended at the 3' end, altering the C-terminus and increasing the predicted protein from 623 to 669 amino acids.
     New:        TCTTATGCTATGCCCCTATTTGTTAAATTTGTTGATGAAATTAAAATGACAGATAA--TC
                 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||
Previous: 320025 TCTTATGCTATGCCCCTATTTGTTAAATTTGTTGATGAAATTAAAATGACAGATAACCTC 320084
Kellis M, et al.  (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
Brachat S, et al.  (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45