CHS2/YBR038W Locus History Help


Nomenclature History
Standard Name Reference
CHS2 Sburlati A and Cabib E  (1986) Chitin synthetase 2, a presumptive participant in septum formation in Saccharomyces cerevisiae. J Biol Chem 261(32):15147-52
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide deletion and a dinucleotide substitution were made in the intergenic region between ORFs CHS2/YBR038W and ATP3/YBR039W.
New    315050  TGTATGAGCTGGGCATCAAGAG-CTTTTGAGATTTTCCAAGTAGTAACTCATCTTTCTGA  315108
               |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Old    315049  TGTATGAGCTGGGCATCAAGAGGCTTTTGAGATTTTCCAAGTAGTAACTCATCTTTCTGA  315108
New    315229  TCGATAAAACAAAAAAAAAGTAAGAAGATATATGAATAGGAGCTGTCGCTAGAACTAGTA  315288
               |||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||
Old    315229  TCGATAAAACAAAAAAAAAGTAAGAAGATATATGAATAGGACGTGTCGCTAGAACTAGTA  315288
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()