UGA2/YBR006W Locus History Help


Nomenclature History
An SGD Standard Name was first assigned to this gene on 2000-11-21.
Standard Name Reference
UGA2 Ramos F, et al.  (1985) Mutations affecting the enzymes involved in the utilization of 4-aminobutyric acid as nitrogen source by the yeast Saccharomyces cerevisiae. Eur J Biochem 149(2):401-4
Other Name(s)Reference
UGA5 Coleman ST, et al.  (2001) Expression of a glutamate decarboxylase homologue is required for normal oxidative stress tolerance in Saccharomyces cerevisiae. J Biol Chem 276(1):244-50
Sequence Annotation Notes
DateNote
1999-04-23Three single nucleotide (nt) substitutions were made to the systematic sequence of Chromosome II within the ORF UGA2/YBR006W, and one substitution was made in the adjacent intergenic region. The C at chromosomal coordinate 247262 was changed to a G, the C at 247367 was changed to a T, the A at 248278 was changed to a T (destroying the stop codon), and the A at 248539 was changed to a T. As a result, the stop was moved 186 nucleotides downstream, increasing the size of the coding sequence from 1308 nt to 1494 nt.
Old: 247261 TCGCAACCATCATTACTTTAGAAAATGGTAAAGCTCTAGGGGAAGCTAAAGGAGAAATCA 247320
            | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New: 247261 TGGCAACCATCATTACTTTAGAAAATGGTAAAGCTCTAGGGGAAGCTAAAGGAGAAATCA 247320
Old: 247321 AATACGCGGCTTCGTATTTTGAGTGGTACGCCGAGGAAGCACCCCGCTTATATGGTGCTA 247380
            |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
New: 247321 AATACGCGGCTTCGTATTTTGAGTGGTACGCCGAGGAAGCACCCCGTTTATATGGTGCTA 247380
AND
Old: 248221 CTAATGATACTGAGTTTGGTTTAGCAGCATATGTCTTTTCTAAAAATGTCAACACTTAAT 248280
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
New: 248221 CTAATGATACTGAGTTTGGTTTAGCAGCATATGTCTTTTCTAAAAATGTCAACACTTTAT 248280
AND
Old: 248521 GTATATATCTATTGCATGAATAAATACTCTACTCCTCGTATATAGAAAGTTAAGTAAATT 248580
            |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
New: 248521 GTATATATCTATTGCATGTATAAATACTCTACTCCTCGTATATAGAAAGTTAAGTAAATT 248580
2011-02-03A single nucleotide insertion was made in the intergenic region between ORFs UGA2/YBR006W and DSF2/YBR007C.
New    248572  GCATGTATAAATACTCTACTCCTCGTATATAGAAAGTTAAGTAAATTTTTTGAAAGAAAA  248631
               |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Old    248574  GCATGTATAAATACTCTACTCCTCGTATATAGAAAGTTAAGTAAATTTTT-GAAAGAAAA  248632
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()