RER2/YBR002C Locus History Help


Nomenclature History
Standard Name Reference
RER2 Nishikawa S and Nakano A  (1993) Identification of a gene required for membrane protein retention in the early secretory pathway. Proc Natl Acad Sci U S A 90(17):8179-83
Sequence Annotation Notes
DateNote
2011-02-03Two separate single nucleotide substitutions were made in the intergenic region between ORFs NTH2/YBR001C and RER2/YBR002C.
New    241352  AAAGGAAAAATATAAATAAATAAATAAAATTGAGAAATAAAGATATTTAGTTTTAATGGA  241411
               ||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||
Old    241354  AAAGGGAAAATATAAATAAATAAATAAAATTGAGAAATAAAGGATATTAGTTTTAATGGA  241413
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()