SEA4/YBL104C Locus History Help


Nomenclature History
Standard Name Reference
SEA4 Dokudovskaya S, et al.  (2011) A conserved coatomer-related complex containing Sec13 and Seh1 dynamically associates with the vacuole in Saccharomyces cerevisiae. Mol Cell Proteomics 10(6):M110.006478
Sequence Annotation Notes
DateNote
2004-01-26Brachat et al. 2003 and Kellis et al. 2003 predicted and confirmed DIFFERENT sequence changes for YBL104C. Brachat et al. demonstrated the insertion of a single G nt, which extended the 3' end by 141 nt and altered the C-terminus, resulting in overlapping ORF YBL103C-A becoming part of YBL104C (Cliften et al. also predicted this change).
     New:       CTTCTGTCTGCATTGGATCGCGTGATTGCGTCCCATTTATTACAAAAGGTAAGTTTGACG 
                ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Previous: 18350 CTTCTGTCTGCATTG-ATCGCGTGATTGCGTCCCATTTATTACAAAAGGTAAGTTTGACG 18408
Kellis et al. demonstrated the insertion of four separate nucleotides (a single T, a single C, and two separate As), which extended at the 5' end by 198 nt and altered the N-terminus. The inserted C (G on the opposite, coding strand) is the third nucleotide of the new ATG start codon.
     New:       ATTATCATATGACCAATGGGTCACTTTTTTGATGAGACCCATGTTTATTCTTCTATACGT 
                ||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||
Previous: 21251 ATTATCATATGACCAATGGGTCACTTTTT-GATGAGACC-ATGTTTATTCTTCTATACGT 21308

     New:       TCGTGATACTGCACTTACGACTACCAGTAACATCAGAATAACCATAGAGC 
                ||||||||||||||||||||||||||||||||||||| || |||||||||
Previous: 21309 TCGTGATACTGCACTTACGACTACCAGTAACATCAGA-TA-CCATAGAGC 21356
Kellis M, et al.  (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
Brachat S, et al.  (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
Cliften P, et al.  (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2011-02-03A single nucleotide insertion was made in the intergenic region between ORFs YBL104C and RTG3/YBL103C.
New    21361   CTTATGCTATCTTGAAATATATCATCGCCGTAAAGTATGATGTGTAGCGCATTAGTCTTC  21420
               |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Old    21361   CTTATGCTATCTTGAA-TATATCATCGCCGTAAAGTATGATGTGTAGCGCATTAGTCTTC  21419
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()