RTG3/YBL103C Locus History Help


Nomenclature History
Standard Name Reference
RTG3 Jia Y, et al.  (1997) A basic helix-loop-helix-leucine zipper transcription complex in yeast functions in a signaling pathway from mitochondria to the nucleus. Mol Cell Biol 17(3):1110-7
Sequence Annotation Notes
DateNote
1997-07-27A single G was inserted after the G at chromosomal coordinate 22603 within the ORF RTG3/YBL103C, shifting the frame and extending the 3' end by 510 nucleotides:
New: 22561 TACCTAGGTCATCGTAATTCAATAAAGATGGTGGAACCAACTGGCCGAGTTCTTTTATCT 22620
           ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Old: 22561 TACCTAGGTCATCGTAATTCAATAAAGATGGTGGAACCAACTG-CCGAGTTCTTTTATCT 22619
2011-02-03A single nucleotide insertion was made in the intergenic region between ORFs YBL104C and RTG3/YBL103C.
New    21361   CTTATGCTATCTTGAAATATATCATCGCCGTAAAGTATGATGTGTAGCGCATTAGTCTTC  21420
               |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Old    21361   CTTATGCTATCTTGAA-TATATCATCGCCGTAAAGTATGATGTGTAGCGCATTAGTCTTC  21419
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
2011-02-03Several sequence changes were made in the intergenic region between ORFs RTG3/YBL103C and SFT2/YBL102W.
New    23821   GAAGGCTTTTCTAATCACCATGGCTTTATTATTTC--AAAAGTAACTTGCGAAGAGTCAC  23878
               |||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||
Old    23820   GAAGGCTTTTCTAATCACCATGGCTTTATTATTTCCCAAAAGTAACTTGCGAAGAGTCAC  23879
New    23879   ATCCCGCGGAACGGCCCGCAATCGTGACCCGGCAAAAGGCGATTGTAATGAAGAGGGAGT  23938
               ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Old    23880   ATCCCGCGGAACGGCCCGCAATCGTGACCCGGCCAAAGGCGATTGTAATGAAGAGGGAGT  23939
New    23939   ATTGGTCAAGACTTGTACTATACTGAAATAGGAAGAAGATTGAATAAATTTGCATTCTAA  23998
               |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Old    23940   ATTGGTCA-GACTTGTACTATACTGAAATAGGAAGAAGATTGAATAAATTTGCATTCTAA  23998
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()