ROX3/YBL093C Locus History Help


Nomenclature History
Standard Name Reference
ROX3 SGD  (2007) Information without a citation in SGD ()
Other Name(s)Reference
MED19 Bourbon HM, et al.  (2004) A unified nomenclature for protein subunits of mediator complexes linking transcriptional regulators to RNA polymerase II. Mol Cell 14(5):553-7
NUT3 Tabtiang RK and Herskowitz I  (1998) Nuclear proteins Nut1p and Nut2p cooperate to negatively regulate a Swi4p-dependent lacZ reporter gene in Saccharomyces cerevisiae. Mol Cell Biol 18(8):4707-18
SSX2 Li L, et al.  (2005) Genetic interactions between mediator and the late G1-specific transcription factor Swi6 in Saccharomyces cerevisiae. Genetics 171(2):477-88
Nomenclature History Notes
DateNote
2014-04-03The SSX2 genetic locus was previously a "Not Physically Mapped" feature in SGD. However, PMID: 15998722 states that SSX2 is allelic to ROX3. SSX2 was merged with ROX3 in April 2014.

Li L, et al.  (2005) Genetic interactions between mediator and the late G1-specific transcription factor Swi6 in Saccharomyces cerevisiae. Genetics 171(2):477-88
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide substitution was made in the intergenic region between ORFs ROX3/YBL093C and RPL32/YBL092W.
New    45479   ACTGGAGAAGAGTGTTTGAATCCAGCAGAAGGTAATACGCACCTTTCTCATCTATTTGCA  45538
               ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Old    45476   ACTGGAGAAGAGTGTTTGATTCCAGCAGAAGGTAATACGCACCTTTCTCATCTATTTGCA  45535
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()