TEL1/YBL088C Locus History Help


Nomenclature History
Standard Name Reference
TEL1 Lustig AJ and Petes TD  (1986) Identification of yeast mutants with altered telomere structure. Proc Natl Acad Sci U S A 83(5):1398-402
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide substitution within the coding region of TEL1/YBL088C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 1412 is now Cysteine rather than Phenylalanine.
New    55139   GCATCAAGGCAGTATTTCCAAGTTTTTATTTTGATGAGATCCCGATGCTCTAAAAGCTTT  55198
               ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Old    55136   GCATCAAGGAAGTATTTCCAAGTTTTTATTTTGATGAGATCCCGATGCTCTAAAAGCTTT  55195
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
2011-02-03A single nucleotide insertion was made in the intergenic region between ORFs TEL1/YBL088C and RPL23A/YBL087C.
New    59399   ATTTCCCTTTTTCTTTGAAGGCTTTTTTTTCGAATTTCCTGCTTTTTTTGCGAGGCTTTG  59458
               ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Old    59396   ATTTCCCTTTT-CTTTGAAGGCTTTTTTTTCGAATTTCCTGCTTTTTTTGCGAGGCTTTG  59454
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
Mapping Notes
DateNote
1992-10-01Edition 11: tel1 is distal to cdc27

Mortimer RK, et al.  (1992) Genetic and physical maps of Saccharomyces cerevisiae, Edition 11. Yeast 8(10):817-902