- Summary
- Locus History
- Literature
- Gene Ontology
- Phenotype
- Interactions
- Expression
- Protein
- Wiki
| Nomenclature History | |
|---|---|
| Standard Name | Reference |
| ATG8 | Klionsky DJ, et al. (2003) A unified nomenclature for yeast autophagy-related genes. Dev Cell 5(4):539-45 |
| Other Name(s) | Reference |
|---|---|
| APG8 | Kirisako T, et al. (1999) Formation process of autophagosome is traced with Apg8/Aut7p in yeast. J Cell Biol 147(2):435-46 Tsukada M and Ohsumi Y (1993) Isolation and characterization of autophagy-defective mutants of Saccharomyces cerevisiae. FEBS Lett 333(1-2):169-74 |
| AUT7 | Harding TM, et al. (1996) Genetic and phenotypic overlap between autophagy and the cytoplasm to vacuole protein targeting pathway. J Biol Chem 271(30):17621-4 |
| CVT5 | Harding TM, et al. (1995) Isolation and characterization of yeast mutants in the cytoplasm to vacuole protein targeting pathway. J Cell Biol 131(3):591-602 |
| Nomenclature History Notes | |
|---|---|
| Date | Note |
| 2003-09-10 | The standard gene name of ORF YBL078C was changed from AUT7 to ATG8, as part of the unified autophagy nomenclature agreed upon by the yeast research community. Sept. 10, 2003 |
| Sequence Annotation Notes | |
|---|---|
| Date | Note |
| 2011-02-03 | A single nucleotide deletion was made in the intergenic region between ORFs ATG8/YBL078C and YBL077W.
New 80708 TTCAGACTTAAATGTAGACTTCATGTCTCTAGTAATTATTTT-ATTATGATTTTCTCAAC 80766
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Old 80705 TTCAGACTTAAATGTAGACTTCATGTCTCTAGTAATTATTTTTATTATGATTTTCTCAAC 80764 |
| Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. () | |



