ATG8/YBL078C Locus History Help


Nomenclature History
Standard Name Reference
ATG8 Klionsky DJ, et al.  (2003) A unified nomenclature for yeast autophagy-related genes. Dev Cell 5(4):539-45
Other Name(s)Reference
APG8 Kirisako T, et al.  (1999) Formation process of autophagosome is traced with Apg8/Aut7p in yeast. J Cell Biol 147(2):435-46 Tsukada M and Ohsumi Y  (1993) Isolation and characterization of autophagy-defective mutants of Saccharomyces cerevisiae. FEBS Lett 333(1-2):169-74
AUT7 Harding TM, et al.  (1996) Genetic and phenotypic overlap between autophagy and the cytoplasm to vacuole protein targeting pathway. J Biol Chem 271(30):17621-4
CVT5 Harding TM, et al.  (1995) Isolation and characterization of yeast mutants in the cytoplasm to vacuole protein targeting pathway. J Cell Biol 131(3):591-602
Nomenclature History Notes
DateNote
2003-09-10The standard gene name of ORF YBL078C was changed from AUT7 to ATG8, as part of the unified autophagy nomenclature agreed upon by the yeast research community. Sept. 10, 2003
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide deletion was made in the intergenic region between ORFs ATG8/YBL078C and YBL077W.
New    80708   TTCAGACTTAAATGTAGACTTCATGTCTCTAGTAATTATTTT-ATTATGATTTTCTCAAC  80766
               |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Old    80705   TTCAGACTTAAATGTAGACTTCATGTCTCTAGTAATTATTTTTATTATGATTTTCTCAAC  80764
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()