RPS8A/YBL072C Locus History Help


Nomenclature History
Standard Name Reference
RPS8A Dieci G, et al.  (2009) Positive modulation of RNA polymerase III transcription by ribosomal proteins. Biochem Biophys Res Commun 379(2):489-93
Other Name(s)Reference
rp19 Planta RJ and Mager WH  (1998) The list of cytoplasmic ribosomal proteins of Saccharomyces cerevisiae. Yeast 14(5):471-7
S14A Planta RJ and Mager WH  (1998) The list of cytoplasmic ribosomal proteins of Saccharomyces cerevisiae. Yeast 14(5):471-7
S8A Planta RJ and Mager WH  (1998) The list of cytoplasmic ribosomal proteins of Saccharomyces cerevisiae. Yeast 14(5):471-7
S8e Jenner L, et al.  (2012) Crystal structure of the 80S yeast ribosome. Curr Opin Struct Biol 22(6):759-67
YS9 Planta RJ and Mager WH  (1998) The list of cytoplasmic ribosomal proteins of Saccharomyces cerevisiae. Yeast 14(5):471-7
Sequence Annotation Notes
DateNote
2007-04-04RPS8A/YBL072C mRNA contains an intron in the 5' untranslated region (UTR).

Cliften P, et al.  (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
Miura F, et al.  (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51
Juneau K, et al.  (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7
2011-02-03A single nucleotide substitution was made within the 5' UTR intron of ORF RPS8A/YBL072C.
New    89267   GGCTTGATTTTTTGGGTACACAAAGGATTCAGTTTAGTGCACTGCTCCTGTCACAATTTA  89326
               |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Old    89265   GGCTTGATTTTTGGGGTACACAAAGGATTCAGTTTAGTGCACTGCTCCTGTCACAATTTA  89324
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()