RPS8A/YBL072C Locus History Help


Nomenclature History
Standard Name Reference
RPS8A SGD  (2007) Information without a citation in SGD ()
Other Name(s)Reference
rp19 Planta RJ and Mager WH  (1998) The list of cytoplasmic ribosomal proteins of Saccharomyces cerevisiae. Yeast 14(5):471-7
S14A Planta RJ and Mager WH  (1998) The list of cytoplasmic ribosomal proteins of Saccharomyces cerevisiae. Yeast 14(5):471-7
S8A Planta RJ and Mager WH  (1998) The list of cytoplasmic ribosomal proteins of Saccharomyces cerevisiae. Yeast 14(5):471-7
S8e Jenner L, et al.  (2012) Crystal structure of the 80S yeast ribosome. Curr Opin Struct Biol 22(6):759-67
YS9 Planta RJ and Mager WH  (1998) The list of cytoplasmic ribosomal proteins of Saccharomyces cerevisiae. Yeast 14(5):471-7
Sequence Annotation Notes
DateNote
2007-04-04RPS8A/YBL072C mRNA contains an intron in the 5' untranslated region (UTR).

Cliften P, et al.  (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
Miura F, et al.  (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51
Juneau K, et al.  (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7
2011-02-03A single nucleotide substitution was made within the 5' UTR intron of ORF RPS8A/YBL072C. 
New    89267   GGCTTGATTTTTTGGGTACACAAAGGATTCAGTTTAGTGCACTGCTCCTGTCACAATTTA  89326
               |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Old    89265   GGCTTGATTTTTGGGGTACACAAAGGATTCAGTTTAGTGCACTGCTCCTGTCACAATTTA  89324
Dietrich F  (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. ()