PRS4/YBL068W Locus History Help


Nomenclature History
Standard Name Reference
PRS4 Carter AT, et al.  (1997) PRS1 is a key member of the gene family encoding phosphoribosylpyrophosphate synthetase in Saccharomyces cerevisiae. Mol Gen Genet 254(2):148-56
Sequence Annotation Notes
DateNote
2008-10-30Data from Nagalakshmi et al. 2008 suggest that there is an in-frame AUG 28 codons upstream of the currently annotated AUG for either all or some of the transcripts of PRS4/YBL068W. The upstream AUG represents the previously annotated start for this ORF; the annotation of which was changed based on comparative DNA sequence data from Kellis et al. 2003 and/or Cliften et al. 2003.

Kellis M, et al.  (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
Cliften P, et al.  (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
Nagalakshmi U, et al.  (2008) The transcriptional landscape of the yeast genome defined by RNA sequencing. Science 320(5881):1344-9
2003-09-22The start site for PRS4/YBL068W was moved 84 nt (28 codons) downstream based on the automated comparison of closely related Saccharomyces species by Kellis et al. 2003. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al.  (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
Cliften P, et al.  (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2011-02-03Two nucleotide substitutions and one trinucleotide deletion were made within the ORF PRS4/YBL068W, altering its coding sequence. The start, stop, and reading frame remain the same, but the annotated protein is now one amino acid shorter.
New    92637   TTAATGATTTCTTGATGGAATTATTAATTTTAATTCATGCTTGCAAAATTGCATCTGCAA  92696
               |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Old    92635   TTAATGATTTCTTGATGGAATTATTAATTTTAATTCATGCTTGCCAAATTGCATCTGCAA  92694

New    92877   ACAACCTATATGCAGAACCAAGTGTTTTAAATTATATTAGAAC---GAAAACAGATTTCG  92933
               ||||||||||||||||||||||||||||||||||||||||| |   ||||||||||||||
Old    92875   ACAACCTATATGCAGAACCAAGTGTTTTAAATTATATTAGAGCCCGGAAAACAGATTTCG  92934
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
2011-02-03A single nucleotide deletion was made in the intergenic region between ORFs PRS4/YBL068W and UBP13/YBL067C.
New    93594   AAAGGAGACGGTGAACCTTTACCTTCC-TTGATATGCAAATATTTTTCAGCTTTTCCTAA  93652
               ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Old    93595   AAAGGAGACGGTGAACCTTTACCTTCCCTTGATATGCAAATATTTTTCAGCTTTTCCTAA  93654
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()