RIB1/YBL033C Locus History Help


Nomenclature History
Standard Name Reference
RIB1 Oltmanns O and Bacher A  (1972) Biosynthesis of riboflavine in Saccharomyces cerevisiae: the role of genes rib 1 and rib 7 . J Bacteriol 110(3):818-22 Revuelta, J.L., et al.  (1992) ; Personal Communication, Mortimer Map Edition 11
Sequence Annotation Notes
DateNote
1999-04-22The C at chromosomal coordinate 159114 within the ORF RIB1/YBL033C was changed to a G, altering translation by changing amino acid 181 from Lys (AAG) to Asn (AAC). Note that this ORF is on the Crick strand:
Old: 159061 CGACCCTCTTGTCTTAGATACACGATAACACCATGGCCGTTTCCACCTTTGATCTTGCTT 159120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
New: 159061 CGACCCTCTTGTCTTAGATACACGATAACACCATGGCCGTTTCCACCTTTGATGTTGCTT 159120
Cherry JM, et al.  (1998) "Genetic and Physical Maps of Saccharomyces cerevisiae (Edition 15)". Pp. 414-420 in 1998 Yeast Genetics and Molecular Biology Meeting Program and Abstracts. Bethesda, MD: The Genetics Society of America