FMT1/YBL013W Locus History Help


Nomenclature History
An SGD Standard Name was first assigned to this gene on 2001-10-09.
Standard Name Reference
FMT1 Li Y, et al.  (2000) Initiation of protein synthesis in Saccharomyces cerevisiae mitochondria without formylation of the initiator tRNA. J Bacteriol 182(10):2886-92
Other Name(s)Reference
methionyl-tRNA transformylase Li Y, et al.  (2000) Initiation of protein synthesis in Saccharomyces cerevisiae mitochondria without formylation of the initiator tRNA. J Bacteriol 182(10):2886-92
Sequence Annotation Notes
DateNote
2004-01-29A single C nucleotide insertion was confirmed by sequencing genomic DNA from FY23 (S288C) and a D273-10B related strain; GenBank accession number for FY23 is AY490279. The stop codon of ORF YBL013W has been moved downstream, so that the ORF is now 1206 nucleotides long as opposed to the previously annotated 1182 nt.
New  1141    GGCCAGTTCATGGCGCGCCTGCGGAAAAGATGCGGCGCCCTGAGTGAAAAGTTAGTTTTC  1200
             ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Old  203163  GGCCAGTTCATGGCGCG-CTGCGGAAAAGATGCGGCGCCCTGAGTGAAAAGTTAGTTTTC  203221