LDB7/YBL006C Locus History Help


Nomenclature History
An SGD Standard Name was first assigned to this gene on 2003-10-16.
Standard Name Reference
LDB7 Corbacho I, et al.  (2004) Identification of low-dye-binding (ldb) mutants of Saccharomyces cerevisiae. FEMS Yeast Res 4(4-5):437-44
Other Name(s)Reference
RSC14 Wilson B, et al.  (2006) The RSC chromatin remodeling complex bears an essential fungal-specific protein module with broad functional roles. Genetics 172(2):795-809
Sequence Annotation Notes
DateNote
2004-01-28Kellis et al. 2003 predicted and confirmed the deletion of a single nucleotide at 216785. As a consequence of this sequence change, YBL006C was extended at the 3' end, altering the C-terminus and increasing the predicted protein from 145 to 180 amino acids. In addition, YBL006W-A was extended at the 3' end, altering the C-terminus and increasing size of the predicted protein from 39 to 49 amino acids.
New 301 TCAAGTGTCGA-CTTTTCGCACCATTTCCACCGCACATTAGAATGCAAAGCTGCTCTAGA  359
        ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Old     TCAAGTGTCGACCTTTTCGCACCATTTCCACCGCACATTAGAATGCAAAGCTGCTCTAGA
Kellis M, et al.  (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54