UTP20/YBL004W Locus History Help


Nomenclature History
An SGD Standard Name was first assigned to this gene on 2003-10-30.
Standard Name Reference
UTP20 Samanta MP and Liang S  (2003) Predicting protein functions from redundancies in large-scale protein interaction networks. Proc Natl Acad Sci U S A 100(22):12579-83
Sequence Annotation Notes
DateNote
2001-05-29A change was made to the systematic sequence of Chromosome II within the ORF UTP20/YBL004W. The C at chromosomal coordinate 234918 was changed to an A:
Old: 234901 CAGACCGTATTAGAAAGCAGAAAGGAAAGGAGATCTAAAAGGGCAATTCTGGCTGTTAAC 234960
            ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
New: 234901 CAGACCGTATTAGAAAGAAGAAAGGAAAGGAGATCTAAAAGGGCAATTCTGGCTGTTAAC 234960