PAU7/YAR020C Locus History Help


Nomenclature History
Standard Name Reference
PAU7 Luo Z and van Vuuren HJ  (2009) Functional analyses of PAU genes in Saccharomyces cerevisiae. Microbiology 155(Pt 12):4036-49
Sequence Annotation Notes
DateNote
2003-12-01Based on the automated comparison of closely related Saccharomyces species, Cliften et al. suggest that the stop site for PAU7/YAR020C be moved 202 nt downstream. This suggestion was reviewed by SGD curators, but will not be incorporated until supported by experimental data. The reason(s) for this decision are as follows: this change would require a sequence change. All potential sequence changes must be confirmed in S288C before being incorporated.

Cliften P, et al.  (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2006-02-21In order to test the sequence change proposed by Cliften et al. (see note from 2003-12-01) SGD resequenced the region immediately surrounding the proposed error. The current S288C sequence was confirmed. As a result, no changes will be made in the sequence or annotation of PAU7/YAR020C."

Cliften P, et al.  (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2011-02-03Several nucleotide sequence changes were made in the intergenic region between ORFs PAU7/YAR020C and YAR023C.
New    177104  CAAAGCTGATCAAGCCGCTGTATTTATATGAAACTTTGAACAACTACATCTGCACACATG  177163
               |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Old    177102  CAAAGCTGATCAAGCCGCTGTATTTATATGAAAC-TTGAACAACTACATCTGCACACATG  177160
New    178244  ACAATTTAACCATGGCAGGTTAAAATATTACTGCGATCAGTAAAAATGGGGATATCACCT  178303
               ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Old    178241  ACAATTTAACCATGGGAGGTTAAAATATTACTGCGATCAGTAAAAATGGGGATATCACCT  178300
New    178599  ATTGT-AGATTGTATCGTTCGAGAAACGTCAGGCATGATAGAT-GTTGCAATCACAGGAC  178656
               ||||| ||||||||||||||||| ||||||||||||||||||| |||||||| |||||||
Old    178596  ATTGTAAGATTGTATCGTTCGAG-AACGTCAGGCATGATAGATGGTTGCAATTACAGGAC  178654
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()