CDC15/YAR019C Locus History Help


Nomenclature History
Standard Name Reference
CDC15 Cid, V.J. and M.Sanchez  (1997) LYT1 is allelic to CDC15. Unpublished results
Nomenclature History Notes
DateNote
2004-11-16CDC15/YAR019C encodes a protein kinase involved in exit from mitosis. Do not confuse CDC15/YAR019C with pombe cdc15, which is similar to the cerevisiae HOF1/YMR032W gene.
2004-11-16CDC7/YDL017W encodes a protein kinase involved in DNA replication. Do not confuse CDC7/YDL017W with pombe cdc7, which is similar to the cerevisiae CDC15/YAR019C gene, which encodes a protein kinase involved in cytokinesis.
Sequence Annotation Notes
DateNote
2011-02-03Nucleotide changes within the coding region of CDC15/YAR019C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 316 is now Alanine rather than Arginine, residue 321 is now Alanine rather than Proline, and 900-902 are now KDV rather than NGC.
New    172416  GAATTCCTTTTTGGGACATCC-TTGTTCCAGTTGTTGTTTAAAAACTCCGTTATTTGTAC  172474
               |||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||
Old    172414  GAATTCCTTTTT-GGACATCCGTTGTTCCAGTTGTTGTTTAAAAACTCCGTTATTTGTAC  172472

New    174165  TCTGCCCAGGCAGCGGGAGCCGCTGCAAGACTGAATTTAGAGGGTGATATATTTAGTTTC  174224
               |||||||||| |||||||||||||  ||||||||||||||||||||||||||||||||||
Old    174163  TCTGCCCAGGGAGCGGGAGCCGCTCGAAGACTGAATTTAGAGGGTGATATATTTAGTTTC  174222
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
2011-02-03Several nucleotide sequence changes were made in the intergenic region between ORFs KIN3/YAR018C and CDC15/YAR019C.
New    171843  GTAATGAAAAAATTCAGAAACCTTAAAAAAAAAACTTGGCTGTAACCTATCGGAAGACTG  171902
               ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Old    171838  GTAATGAAAAAATTCAGAAACCTTAAAAAAAAAACTTGGCTGTAA-CTATCGGAAGACTG  171896
New    171953  CTAGAAACATTTAACAAAATG-CACTTT---GAGTC-GTTCATACATTTAATCCCCAATT  172007
               ||||||||||||||||||||| ||| ||   ||||| |||||||||||||||||||||||
Old    171947  CTAGAAACATTTAACAAAATGCCACCTTCTAGAGTCGGTTCATACATTTAATCCCCAATT  172006
New    172008  GAAAAAAAAAA-G-AAAAGAAAAAAAGCATATATATGTATATGCTTTTTTATCATTACTG  172065
               ||||||||||| | ||||||||||||||||||||| | ||||||||||||||||||||||
Old    172007  GAAAAAAAAAAAGAAAAAGAAAAAAAGCATATATA-G-ATATGCTTTTTTATCATTACTG  172064
New    172126  GGAAGGTTCACAATTCTATATATAGTGTTAATGTAATGCTGTATTATTTCTCTATATATG  172185
               |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Old    172125  GGAAGGTTCACAATTCTATATATAGTGTTAATGTAATGCTGTATTA-TTCTCTATATATG  172183
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
Mapping Notes
DateNote
1997-10-20Edition 14: cdc15 is allelic to lyt1

Cherry JM, et al.  (1997) Genetic and physical maps of Saccharomyces cerevisiae. Nature 387(6632 Suppl):67-73