SEN34/YAR008W Locus History Help


Nomenclature History
Standard Name Reference
SEN34 Trotta CR, et al.  (1997) The yeast tRNA splicing endonuclease: a tetrameric enzyme with two active site subunits homologous to the archaeal tRNA endonucleases. Cell 89(6):849-58
Other Name(s)Reference
FUN4 Steensma HY, et al.  (1987) Molecular cloning of chromosome I DNA from Saccharomyces cerevisiae: isolation and analysis of the CEN1-ADE1-CDC15 region. Mol Cell Biol 7(1):410-9
tRNA splicing endonuclease subunit Trotta CR, et al.  (1997) The yeast tRNA splicing endonuclease: a tetrameric enzyme with two active site subunits homologous to the archaeal tRNA endonucleases. Cell 89(6):849-58
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide insertion was made in the intergenic region between ORFs RFA1/YAR007C and SEN34/YAR008W.
New    158923  TAACATATATGCAAAAAGAACGGCAAAAGGCGAGGAGGTTTTTATGCCACCGCTAGTATT  158982
               |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Old    158925  TAACATATAT-CAAAAAGAACGGCAAAAGGCGAGGAGGTTTTTATGCCACCGCTAGTATT  158983
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()