SEO1/YAL067C Locus History Help


Nomenclature History
Standard Name Reference
SEO1 Isnard AD, et al.  (1996) The study of methionine uptake in Saccharomyces cerevisiae reveals a new family of amino acid permeases. J Mol Biol 262(4):473-84
Nomenclature History Notes
DateNote
2003-12-09SEO1 has been used to refer to both SSQ1/YLR369W, which encodes a mitochondrial matrix chaperone, and SEO1/YAL067C, which encodes a putative transporter.
Sequence Annotation Notes
DateNote
2011-02-03Several nucleotide sequence changes were made in the intergenic region between ORFs YAL067W-A and SEO1/YAL067C.
New    3791    CTTGGTAGTAACCATAATATTACCCAGGTACGAAACGCTAAGAAC-TTGAAAGACTCATA  3849
               ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Old    3791    CTTGGTAGTAACCATAATATTACCCAGGTACGAAACGCTAAGAACCTTGAAAGACTCATA  3850
New    3960    TTTCCATTTTGATAATGAGCTAGTGATCCGGAAAGCTACTTTATGATGTTTCAAGGCCTG  4019
               ||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||
Old    3961    TTTCCATTTTGATAATGAGCATGTGATCCGGAAAGCTACTTTATGATGTTTCAAGGCCTG  4020
New    5220    TAAATAGTTTTCAACTGCTGGTGATAAATCAATAATTTATGTTCTTAACCTAACATTTGA  5279
               ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Old    5221    TAAATAGTTTTCAACTGCTGGTGGTAAATCAATAATTTATGTTCTTAACCTAACATTTGA  5280
New    5880    AACTGCATTCGGACTATGAAAGAAAAAATGGTAGTAGCAAAGGATAGGCATCGCCGTATT  5939
               ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Old    5881    AACTGCATTCGGACTATGAAAGAAAAAATGGTAGTAGCAAAGGATAG-CATCGCCGTATT  5939
New    6420    AAGTTTCTTAAATAACCCGGATTGGTTAGGTTCA-GCCATGCCTGGCGCGTACATTGAGG  6478
               |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Old    6420    AAGTTTCTTAAATAACCCGGATTGGTTAGGTTCACGCCATGCCTGGCGCGTACATTGAGG  6479
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
Mapping Notes
DateNote
1998-11-10Edition 15: The gene name SEO1 has also been used to refer to the mitochondrial hsp70-type molecular chaperone, SSQ1

Cherry JM, et al.  (1998) "Genetic and Physical Maps of Saccharomyces cerevisiae (Edition 15)". Pp. 414-420 in 1998 Yeast Genetics and Molecular Biology Meeting Program and Abstracts. Bethesda, MD: The Genetics Society of America