ECM1/YAL059W Locus History Help


Nomenclature History
Standard Name Reference
ECM1 Lussier M, et al.  (1997) Large scale identification of genes involved in cell surface biosynthesis and architecture in Saccharomyces cerevisiae. Genetics 147(2):435-50
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide substitution within the coding regions of overlapping ORFs ECM1/YAL059W and YAL059C-A resulted in altered protein sequences for both ORFs. The start, stop, and reading frames remain the same for both proteins, but ECM1/YAL059W protein residue 102 is now Alanine rather than Aspartic Acid, and YAL059C-A protein residue 36 is now Alanine rather than Serine.
New    36776   AAGAAGTTAAATAAAAAGGCTCTGGAAGACAAACTGGCCAACTCTATTTCATCCATGGAC  36835
               ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Old    36777   AAGAAGTTAAATAAAAAGGCTCTGGAAGACAAACTGGACAACTCTATTTCATCCATGGAC  36836
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()