GCV3/YAL044C Locus History Help


Nomenclature History
Standard Name Reference
GCV3 Nagarajan L and Storms RK  (1997) Molecular characterization of GCV3, the Saccharomyces cerevisiae gene coding for the glycine cleavage system hydrogen carrier protein. J Biol Chem 272(7):4444-50
Sequence Annotation Notes
DateNote
2003-09-22The start site of GCV3/YAL044C was moved 21 nt (7 codons) downstream, based on the automated comparison of closely-related Saccharomyces species by Kellis et al. 2003. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been updated. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al.  (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
Cliften P, et al.  (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2008-03-05Three single base substitutions were made within ORF YAL044C/GCV3 to correct errors in the systematic reference sequence for Chromosome I: Two separate A -> C transversions at 58196 and 58247, and a C -> T transition at 58424. These errors were verified by sequencing in 3 different strains, all of ResGen BY4741 (S288C) background. SGD thanks Michael E. Rice for bringing these errors to our attention, and for verifying the correct sequence.
New:   58191 TTGGGCAATCTCAGTGCCCACTTCTGGCAACTCAACATAGGTAGCGTCCCCTAAGGCATC 58250
             ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||| 
Old:   58191 TTGGGAAATCTCAGTGCCCACTTCTGGCAACTCAACATAGGTAGCGTCCCCTAAGGAATC 58250

New:   58251 AGTGGCGTATTTTGTAATTCCGACAAAGGCAGTCTTGTCCTGATGCACAGCTATCCACTC 58310
             |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Old:   58251 AGTGGCGTATTTTGTAATTCCGACAAAGGCAGTCTTGTCCTGATGCACAGCTATCCACTC 58310

New:   58311 ATGTTGGGAAGTGTACCTCACGGCTTGAGGTCCTTGGGATGAGTACAAAAATGGTAGTTT 58370
             |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Old:   58311 ATGTTGGGAAGTGTACCTCACGGCTTGAGGTCCTTGGGATGAGTACAAAAATGGTAGTTT 58370

New:   58371 ATTCTTGTTTAGGGCATTGCCGGAGCTGTTTCTCAAAAACAATTTGCTCACAGTGGGCAT 58430
             ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| 
Old:   58371 ATTCTTGTTTAGGGCATTGCCGGAGCTGTTTCTCAAAAACAATTTGCTCACAGCGGGCAT 58430