CDC24/YAL041W Locus History Help


Nomenclature History
Standard Name Reference
CDC24 Hartwell LH, et al.  (1973) Genetic Control of the Cell Division Cycle in Yeast: V. Genetic Analysis of cdc Mutants. Genetics 74(2):267-286
Other Name(s)Reference
CLS4 Ohya Y, et al.  (1986) Calcium-sensitive cls4 mutant of Saccharomyces cerevisiae with a defect in bud formation. J Bacteriol 165(1):28-33
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide substitution was made in the intergenic region between ORFs ERV46/YAL042W and CDC24/YAL041W.
New    62756   TAGGATAGCAGAAGAGTACCATTGCTGTTATCATTTGTTGCCTAGCCCTATCAAGACCTG  62815
               |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Old    62757   TAGGATAGCAAAAGAGTACCATTGCTGTTATCATTTGTTGCCTAGCCCTATCAAGACCTG  62816
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()