CDC19/YAL038W Locus History Help


Nomenclature History
Standard Name Reference
CDC19 Link, A. and Olson, M.  (1989) Personal Communication, Mortimer Map Edition 10
Other Name(s)Reference
PYK1 Sprague GF Jr  (1977) Isolation and characterization of a Saccharomyces cerevisiae mutant deficient in pyruvate kinase activity. J Bacteriol 130(1):232-41
Sequence Annotation Notes
DateNote
2011-02-03Two separate single nucleotide substitutions were made in the intergenic region between ARS106 and ORF CDC19/YAL038W.
New    70746   GGTTTTCCGACTTTATTTGAGATGACTTGAGATGTGTGTCAATGCTAGTATTTTGGAGAT  70805
               ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Old    70747   GGTTTTCCGACTTTATTTGAGATGACTTGAGATGTGTGTCAATGCTACTATTTTGGAGAT  70806
New    70856   TTATTTTTTTTTTGTTAGAATTGATCCAAATGTAAATAAACAATCACAAGGAAAAAAAAA  70915
               ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Old    70857   TTATTTTTTTTTTGTTAAAATTGATCCAAATGTAAATAAACAATCACAAGGAAAAAAAAA  70916
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
Mapping Notes
DateNote
1989-10-01Edition 10: cdc19 is 85 kb from Tel-L

Mortimer RK, et al.  (1989) Genetic map of Saccharomyces cerevisiae, edition 10. Yeast 5(5):321-403
2012-08-21The section of the left arm of Chromosome I spanning YAL023C to YAL062W and the section of the right arm of Chromosome XV spanning YOR321W to YOR375C represent paralogous segments that arose from the whole genome duplication. These regions contain the following pairs of paralogous genes:


YAL023C/PMT2 and YOR321W/PMT3
YAL028W/FRT2 and YOR324C/FRT1
YAL029C/MYO4 and YOR326W/MYO2
YAL030W/SNC1 and YOR327C/SNC2
YAL034C/FUN19 and YOR338W
YAL037W and YOR342C
YAL038W/CDC19 and YOR347C/PYK2
YAL051W/OAF1 and YOR363C/PIP2
YAL053W/FLC2 and YOR365C
YAL056W/GPB2 and YOR371C/GPB1
YAL062W/GDH3 and YOR375C/GDH1

Byrne KP and Wolfe KH  (2005) The Yeast Gene Order Browser: combining curated homology and syntenic context reveals gene fate in polyploid species. Genome Res 15(10):1456-61