MDM10/YAL010C Locus History Help


Nomenclature History
Standard Name Reference
MDM10 SGD  (2007) Information without a citation in SGD ()
Other Name(s)Reference
FUN37 Clark MW, et al.  (1994) Sequencing of chromosome I of Saccharomyces cerevisiae: analysis of the 42 kbp SPO7-CENI-CDC15 region. Yeast 10(4):535-41
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide substitution within the coding region of MDM10/YAL010C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 272 is now Asparagine rather than Glutamine.
New    134813  TGGCCGAATATGTGGAGGATATATGGCCGAATAATGGATTCCAAGATAATGTCAAAGTTA  134872
               ||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||
Old    134815  TGGCCGAATATGTGGAGGATATATGGCCGAATAATGGTTGCCAAGATAATGTCAAAGTTA  134874
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
2011-02-03A single nucleotide substitution was made in the intergenic region between ORFs SWC3/YAL011W and MDM10/YAL010C.
New    134093  ATTCTGCTTTAACGCCATTATGATTATACACATTGTATTACTTATTTTTTAACCTGTATA  134152
               |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Old    134096  ATTCTGCTTTAACGCCATTATGATTATACA-ATTGTATTACTTATTTTTTAACCTGTATA  134154
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()