SSA1/YAL005C Locus History Help


Nomenclature History
Standard Name Reference
SSA1 Slater, M.  (1989) Personal Communication, Mortimer Map Edition 10
Other Name(s)Reference
YG100 Ingolia TD, et al.  (1982) Saccharomyces cerevisiae contains a complex multigene family related to the major heat shock-inducible gene of Drosophila. Mol Cell Biol 2(11):1388-98
Sequence Annotation Notes
DateNote
2007-04-05Three single nucleotide substitutions were made within the coding sequence of SSA1 (at nucleotide positions 623, 1252, and 1265 relative to the SSA1 coding sequence), based on the sequence reported by Slater and Craig (1989) and corresponding to GenBank entry X12926. These changes result in phenylalanine to serine changes at amino acid residues 208 and 422 and a change from serine to proline at amino acid residue 418. Thanks to Andreas Bracher for bringing these corrections to our attention.

Note that the change at position 623 of SSA1 also affects the coding sequence of the Dubious ORF YAL004W. 

638     ATACCGTCTTCAATGGACAACAAAGAGAC 610     new sequence, coordinates relative to SSA1 coding region
        ||||||||||||||| |||||||||||||       
140796  ATACCGTCTTCAATGAACAACAAAGAGAC 140824  old sequence, chromosomal coordinates


1279   TGGAAAAGATCTCGGACTTCTTTGTTGGAATGGTAGAGTTT 1239    new sequence, coordinates relative to SSA1 coding region
       |||||||||||||| |||||||||||| |||||||||||||
140155 TGGAAAAGATCTCGAACTTCTTTGTTGAAATGGTAGAGTTT 140195  old sequence, chromosomal coordinates
Slater MR and Craig EA  (1989) The SSA1 and SSA2 genes of the yeast Saccharomyces cerevisiae. Nucleic Acids Res 17(2):805-6
Mapping Notes
DateNote
1992-10-01Edition 11: ssa1 is allelic to YG100; YG100 has been physically mapped between trn1 and the centromere (see Edition 10)

Mortimer RK, et al.  (1992) Genetic and physical maps of Saccharomyces cerevisiae, Edition 11. Yeast 8(10):817-902