HML Summary Help

Standard Name HML
Feature Type gene_cassette|silenced_gene
Description Mating type cassette - left (see Summary Paragraph)
Chromosomal Location
ChrIII:11146 to 14849 | ORF Map | GBrowse
Gbrowse
Genetic position: -49 cM
sequence information
ChrIII:11146 to 14849 | ORF Map | GBrowse
This feature contains embedded feature(s): HMLALPHA1 | HMLALPHA2 | ARS301 | ARS302
SGD ORF map
Genetic position: -49 cM
Last Update Coordinates: 2007-12-10 | Sequence: 2007-12-10
Subfeature details
Relative
Coordinates
Chromosomal
Coordinates
Most Recent Updates
Coordinates Sequence
W region 364..1093 11509..12238 2007-12-10 2007-12-10
X region 1094..1798 12239..12943 2007-12-10 2007-12-10
Y region 1799..2545 12944..13690 2007-12-10 2007-12-10
Z1 region 2546..2784 13691..13929 2007-12-10 2007-12-10
Z2 region 2785..2872 13930..14017 2007-12-10 2007-12-10
Retrieve sequences
Resources
External Links Search all NCBI (Entrez)
Primary SGDIDS000029214
SUMMARY PARAGRAPH for HML

Haploid yeast can fuse to form a diploid when cells of opposite mating type, termed a and alpha, are mixed. a-type cells secrete mating pheromone named a-factor while alpha cells secrete alpha-factor. Alpha cells undergo a characteristic response to a-factor that results in fusion with an a cell while a cells similarly respond to alpha-factor (1, 2). The mating type of S. cerevisiae is determined by the genetic composition of the MAT locus (3). MATa haploids express the genes a1 and a2 from the MAT locus while MATalpha haploids express alpha1 and alpha2 from MAT (4). Diploids must be heterozygous at the MAT locus to be able to sporulate and to not respond to pheromone. Note that the sequence and annotation provided by SGD is based on the systematic sequencing of the S288C strain, which is MATalpha.

Most laboratory strains are heterothallic, with stable mating types. Some strains carry an active HO gene and are homothallic, meaning that as haploids they are capable of switching mating type by changing the genetic composition of the MAT locus to the opposite mating type, and descendants of the original cell can thus mate and form non-mating diploids, where HO is turned off (4).

In addition to the MAT locus, most strains carry two unexpressed, but complete, copies of mating-type genes at the silent loci, HML and HMR. The mechanism of silencing of the HMR and HML loci by Sir2 histone deacetylase and its associated SIR1, SIR3 and SIR4 proteins serves as a model for the silencing of gene expression in many systems. Mating-type switching involves replacement of the Ya or Yalpha sequences present at the MAT locus with either the a or alpha genes located at one of the HM loci. This process is stimulated by the HO endonuclease, creating a double-strand break; HO cleaves at least two different sequences, with 24 bp recognition sequence that spans the Y-Z junction of the MAT locus. Sequence replacement occurs by gene conversion, leaving the donor unaltered. In addition, MATa recombines selectively with HMLalpha while MATalpha prefers HMRa, but the preference is a reflection of the chromosomal position of the donor rather than its a or alpha content (5). The model of mating-type switching diagrammed by Ira Herskowitz is provided below with permission from Genetics (6).

In the sequence derived from the MATalpha S288C strain stored in SGD, the HML locus carries alpha information (HMLalpha) while HMR carries a-specific sequences (HMRa). In the systematic sequence of S288C distal to HMRa1, the sequence contains a "stuck" (stk) mutation at position Z1-11. The beginning of the Z1 sequence is: CGCAACAGTAAAATTTTATAA (Z1-11 (A)). In contrast, the MATalpha1 and HMLalpha1 sequences have the normal, cuttable CGCAACAGTATAATTTTATAA (Z1-11 (T)). When the stk mutation is within the MAT locus, this mutation severely reduces HO endonuclease cleavage.

The preferential use of HML in MATa cells and the equivalently biased use of HMR by MATalpha cells is governed by a small, cis-acting element called the Recombination Enhancer (RE) that lies 17 kb centromere proximal to HML (7). RE contains a canonical binding site for the Matalpha2-Mcm1 repressor complex (8, 9) that turns off a-specific genes by establishing a highly ordered array of positioned nucleosomes that prevent other proteins from binding to the region (10). When RE is inactive (in MATalpha cells) or deleted in MATa cells, HMR is used 90% of the time (11).

Thanks to Jim Haber and Abram Gabriel for valuable feedback on this and other MAT-related gene summary paragraphs.

Last updated: 2005-08-19

References cited on this page View Complete Literature Guide for HML
1) Leberer E, et al.  (1997) Pheromone signalling and polarized morphogenesis in yeast. Curr Opin Genet Dev 7(1):59-66
2) Marsh L, et al.  (1991) Signal transduction during pheromone response in yeast. Annu Rev Cell Biol 7():699-728
3) Herskowitz I  (1983) Cellular differentiation, cell lineages, and transposable genetic cassettes in yeast. Curr Top Dev Biol 18:1-14
4) Haber JE  (1998) Mating-type gene switching in Saccharomyces cerevisiae. Annu Rev Genet 32:561-99
5) Klar AJ, et al.  (1982) Directionality of yeast mating-type interconversion. Cell 28(3):551-61
6) Botstein D  (2004) Ira Herskowitz: 1946-2003. Genetics 166(2):653-60
7) Wu X and Haber JE  (1996) A 700 bp cis-acting region controls mating-type dependent recombination along the entire left arm of yeast chromosome III. Cell 87(2):277-85
8) Szeto L, et al.  (1997) Alpha2p controls donor preference during mating type interconversion in yeast by inactivating a recombinational enhancer of chromosome III. Genes Dev 11(15):1899-911
9) Wu C, et al.  (1998) Mcm1 regulates donor preference controlled by the recombination enhancer in Saccharomyces mating-type switching. Genes Dev 12(11):1726-37
10) Houston P, et al.  (2004) The Saccharomyces cerevisiae recombination enhancer biases recombination during interchromosomal mating-type switching but not in interchromosomal homologous recombination. Genetics 166(3):1187-97
11) Wu X and Haber JE  (1995) MATa donor preference in yeast mating-type switching: activation of a large chromosomal region for recombination. Genes Dev 9(15):1922-32