Restriction Map of ATG29/YPL166W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

ATG29/YPL166W on chromosome XVI from coordinates 237338 to 237979.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.4568

TatI MseI |Csp6I TspDTI | BsmAI ||RsaI | Tsp4CI* | Eco31I \\\ \ \ \ \ ATGATTATGAATAGTACAAACACAGTTGTATATATCAAAGTTAAGGGTAGGAGACCACAG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTAATACTTATCATGTTTGTGTCAACATATATAGTTTCAATTCCCATCCTCTGGTGTC /// / / / / ||| | Tsp4CI* MseI Eco31I ||| TspDTI BsmAI ||TatI |Csp6I RsaI M I M N S T N T V V Y I K V K G R R P Q * L * I V Q T Q L Y I S K L R V G D H R D Y E * Y K H S C I Y Q S * G * E T T G ----:----|----:----|----:----|----:----|----:----|----:----| X I I F L V F V T T Y I L T L P L L G C X S * S Y Y L C L Q I Y * L * P Y S V V H N H I T C V C N Y I D F N L T P S W L TfiI HinfI | BinI* | | MboI | | BamHI | | XhoII | | | DpnI | | | NlaIV | | | |BstKTI | | | || BinI* BaeI | | | || | ApoI | AluI | | | || | TspEI | CviJI | | | || | | MnlI | | SetI \ \ \ \\ \ \ \ \ \ \ GGATTCTTGGATCCTCCCAAATTTGAGTGGAATGGAACAAAGGAGCGACAGCTTTGGACA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CCTAAGAACCTAGGAGGGTTTAAACTCACCTTACCTTGTTTCCTCGCTGTCGAAACCTGT / // / / // / / / | || | | |TspEI BaeI | CviJI | || | | |ApoI | AluI | || | | MnlI SetI | || | BinI* | || XhoII | || BamHI | || MboI | |NlaIV | |DpnI | BstKTI HinfI BinI* TfiI G F L D P P K F E W N G T K E R Q L W T D S W I L P N L S G M E Q R S D S F G Q I L G S S Q I * V E W N K G A T A L D N ----:----|----:----|----:----|----:----|----:----|----:----| P N K S G G L N S H F P V F S R C S Q V P I R P D E W I Q T S H F L P A V A K S S E Q I R G F K L P I S C L L S L K P C MboI ApoI TspEI | DpnI ApoI TspEI | BaeI | |BstKTI TspEI SspI \ \ \ \ \\ \ \ ATGGTATCAAATTTGAATTATTCACAAGATCAAATAGATTGGCAGAATTTATCAAAAATA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TACCATAGTTTAAACTTAATAAGTGTTCTAGTTTATCTAACCGTCTTAAATAGTTTTTAT / / / // / / / | | TspEI || MboI TspEI SspI | BaeI |DpnI ApoI TspEI BstKTI ApoI M V S N L N Y S Q D Q I D W Q N L S K I W Y Q I * I I H K I K * I G R I Y Q K Y G I K F E L F T R S N R L A E F I K N I ----:----|----:----|----:----|----:----|----:----|----:----| I T D F K F * E C S * I S Q C F K D F I L P I L N S N N V L D F L N A S N I L F H Y * I Q I I * L I L Y I P L I * * F Y ApoI TspEI | XmnI MseI TspEI DdeI \ \ \ \ \ TTTGAAACGCCTGAATTTTTTCTTAAAAAGAGAACATATAAATTATTTGCTGAACACTTA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AAACTTTGCGGACTTAAAAAAGAATTTTTCTCTTGTATATTTAATAAACGACTTGTGAAT / / / / TspEI MseI TspEI DdeI XmnI ApoI F E T P E F F L K K R T Y K L F A E H L L K R L N F F L K R E H I N Y L L N T * * N A * I F S * K E N I * I I C * T L R ----:----|----:----|----:----|----:----|----:----|----:----| N S V G S N K R L F L V Y L N N A S C K I Q F A Q I K E * F S F M Y I I Q Q V S K F R R F K K K F L S C I F * K S F V * MboI BglII XhoII MboI | DpnI BclI AluI | |BstKTI | DpnI CviJI MfeI | ||SmlI | |BstKTI | SetI TspEI | ||Hpy178III* | ||Bce83I* \ \ \ \ \\\ \ \\\ GAGCTTTTACAACTACAATTGGAGAAAAAAAGAGATCTTGAGAAGTATTCAAATGATCAA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CTCGAAAATGTTGATGTTAACCTCTTTTTTTCTCTAGAACTCTTCATAAGTTTACTAGTT / / / // / / / // / / | CviJI TspEI || | | SmlI || | Hin4II* | AluI MfeI || | Hpy178III* || BclI SetI || XhoII || MboI || BglII |Bce83I* || MboI |DpnI |DpnI BstKTI BstKTI E L L Q L Q L E K K R D L E K Y S N D Q S F Y N Y N W R K K E I L R S I Q M I K A F T T T I G E K K R S * E V F K * S S ----:----|----:----|----:----|----:----|----:----|----:----| S S K C S C N S F F L S R S F Y E F S * L A K V V V I P S F F L D Q S T N L H D L K * L * L Q L F F S I K L L I * I I L BseGI |Hpy188I || TspDTI || | MseI Hin4II* || | | FokI \ \\ \ \ \ GTGAATGAAGGGATGTCTGATTTAATACATAAATATACCCCTACTTTACAAAATGATAAT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CACTTACTTCCCTACAGACTAAATTATGTATTTATATGGGGATGAAATGTTTTACTATTA / // / / | || | FokI | || MseI | |TspDTI | Hpy188I BseGI V N E G M S D L I H K Y T P T L Q N D N * M K G C L I * Y I N I P L L Y K M I I E * R D V * F N T * I Y P Y F T K * * S ----:----|----:----|----:----|----:----|----:----|----:----| T F S P I D S K I C L Y V G V K C F S L L S H L S T Q N L V Y I Y G * K V F H Y H I F P H R I * Y M F I G R S * L I I I TfiI AciI HinfI | Cac8I SecI* | TspGWI | | CviJI DsaI* | | Hpy188I MseI | | |BciVI TspRI | | | BsmAI \ \ \ \\ \ \ \ \ \ CTATTAAATGTATCCGCAAGCCCACTGACCACGGAAAGACAGGATTCTGAAGAAGTTGAG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GATAATTTACATAGGCGTTCGGGTGACTGGTGCCTTTCTGTCCTAAGACTTCTTCAACTC / / / / / / // / / MseI | | BciVI DsaI* | |Hpy188I | MboII | | CviJI SecI* | HinfI BsmAI | | TspRI | TfiI | Cac8I TspGWI AciI L L N V S A S P L T T E R Q D S E E V E Y * M Y P Q A H * P R K D R I L K K L R I K C I R K P T D H G K T G F * R S * D ----:----|----:----|----:----|----:----|----:----|----:----| R N F T D A L G S V V S L C S E S S T S D I L H I R L G V S W P F V P N Q L L Q * * I Y G C A W Q G R F S L I R F F N L MboII | MaeIII | | Eco57I | | Eco57MI ApoI | | |MnlI MaeIII CviRI* TspEI \ \ \\ \ \ \ ACAGAAGTAACAAATGAGGCGTTACAACATTTGCAAACTTCCAAAATTTTGAACATTCAC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TGTCTTCATTGTTTACTCCGCAATGTTGTAAACGTTTGAAGGTTTTAAAACTTGTAAGTG / / / / / / | | MaeIII MaeIII CviRI* TspEI | MnlI ApoI Eco57MI Eco57I T E V T N E A L Q H L Q T S K I L N I H Q K * Q M R R Y N I C K L P K F * T F T R S N K * G V T T F A N F Q N F E H S Q ----:----|----:----|----:----|----:----|----:----|----:----| V S T V F S A N C C K C V E L I K F M * S L L L L H P T V V N A F K W F K S C E C F Y C I L R * L M Q L S G F N Q V N V BseGI | MseI Hpy188I CviJI TspEI BccI | VspI \ \ \ \ \ \ AAGAAAACATCGGATAGTGAGAATAAGCCTAATGACAAATTGGATAAGGATGGTATTAAT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTTTGTAGCCTATCACTCTTATTCGGATTACTGTTTAACCTATTCCTACCATAATTA / / / / / / Hpy188I CviJI | BccI BseGI VspI TspEI MseI K K T S D S E N K P N D K L D K D G I N R K H R I V R I S L M T N W I R M V L I E N I G * * E * A * * Q I G * G W Y * * ----:----|----:----|----:----|----:----|----:----|----:----| L F V D S L S F L G L S L N S L S P I L C S F M P Y H S Y A * H C I P Y P H Y * L F C R I T L I L R I V F Q I L I T N I TaqI | AluI | CviJI | |SmlI | |AflII | ||MseI Hin4I | ||SetI Hin4I | |||MmeI | Hpy188I | |||| Hin4I FokI AciI | | MboII | |||| Hin4I \ \ \ \ \ \ \\\\ \ AAAGAAATGGAGTGCGGTAGTTCAGATGACGATTTATCTTCGAGCTTAAGTGTTAGTAAA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCTTTACCTCACGCCATCAAGTCTACTGCTAAATAGAAGCTCGAATTCACAATCATTT / / / / / / /// // FokI | AciI | MboII | ||| |AflII Hin4I Hpy188I | ||| |SmlI Hin4I | ||| MseI | ||Hin4I | ||Hin4I | |MmeI | CviJI | AluI TaqI SetI K E M E C G S S D D D L S S S L S V S K K K W S A V V Q M T I Y L R A * V L V N R N G V R * F R * R F I F E L K C * * I ----:----|----:----|----:----|----:----|----:----|----:----| L S I S H P L E S S S K D E L K L T L L Y L F P T R Y N L H R N I K S S L H * Y F F H L A T T * I V I * R R A * T N T F Hin6I |GlaI |Eco47III ||HhaI |||HaeII CviRI* |||| MboII |TspEI Hpy188I \\\\ \ \\ \ TCTGCGTTGGAAGAAGCGCTAATGGACAGATTGCAATTCTGA 610 620 630 640 ----:----|----:----|----:----|----:----|-- AGACGCAACCTTCTTCGCGATTACCTGTCTAACGTTAAGACT //// / / // |||| MboII | |Hpy188I |||Hin6I | TspEI ||Eco47III CviRI* ||GlaI |HhaI HaeII S A L E E A L M D R L Q F * L R W K K R * W T D C N S X C V G R S A N G Q I A I L X ----:----|----:----|----:----|----:----|-- D A N S S A S I S L N C N Q I Q T P L L A L P C I A I R R R Q F F R * H V S Q L E S # Enzymes that cut Frequency Isoschizomers AciI 2 BspACI,SsiI AflII 1 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AluI 3 AluBI ApoI 5 AcsI,XapI BaeI 1 BamHI 1 BccI 1 Bce83I* 1 BpuEI BciVI 1 BfuI BclI 1 FbaI,Ksp22I BglII 1 BinI* 2 AlwI,BspPI,AclWI BseGI 2 BstF5I,BtsCI BsmAI 2 Alw26I,BstMAI BstKTI 4 Cac8I 1 BstC8I Csp6I 1 CviQI,RsaNI CviJI 5 CviKI-1 CviRI* 2 HpyCH4V DdeI 1 BstDEI,HpyF3I DpnI 4 MalI DsaI* 1 BtgI,BstDSI Eco31I 1 Bso31I,BspTNI,BsaI Eco47III 1 Aor51HI,AfeI Eco57I 1 AcuI Eco57MI 1 FokI 2 GlaI 1 HaeII 1 BstH2I HhaI 1 BstHHI,CfoI,AspLEI Hin4I 2 Hin4II* 1 HpyAV Hin6I 1 HinP1I,HspAI HinfI 2 Hpy178III* 1 Hpy188III Hpy188I 5 MaeIII 2 MboI 4 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 3 MfeI 1 MunI MmeI 1 MnlI 2 MseI 6 Tru1I,Tru9I NlaIV 1 BspLI,BmiI,PspN4I RsaI 1 AfaI SecI* 1 BseDI,BssECI,BsaJI SetI 3 SmlI 2 SmoI SspI 1 TaqI 1 TatI 1 TfiI 2 PfeI Tsp4CI* 1 HpyCH4III,TaaI,Bst4CI TspDTI 2 TspEI 10 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 1 TscAI VspI 1 PshBI,AseI XhoII 2 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflIII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuI* AsuII AvaI AvaII AvrII BalI BarI BbvCI BbvI BbvII* BceAI BcgI BdaI BetI* BfiI BglI BisI BlsI BmeT110I BmgT120I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseBI BseMII BsePI BseRI BseSI BseYI BsgI BsiI* BsiYI* BslFI BsmFI BsmI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BsrI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtrI BtsI CauII* Cfr10I Cfr9I CfrI ClaI CspCI CviAII DinI DraII DraIII DrdI Eam1105I EciI Ecl136II EcoICRI EcoNI EcoP15I EcoRI EcoRII EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FatI FauI Fnu4HI FnuDII* FseI FspAI GsaI GsuI HaeIII HgaI HgiAI* HgiCI* HgiJII* HindII HindIII HpaI HpaII HphI Hpy166II Hpy8I Hpy99I KasI KpnI Ksp632I* MaeI MaeII MauBI McrI* MluI MlyI Mph1103I MroNI MslI MstI* MvaI MwoI NaeI NarI NcoI NdeI NgoMIV NheI NlaIII NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI ScrFI SduI SexAI SfaNI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI StyD4I StyI SwaI TaiI TaqII TauI TseI TsoI Tsp45I TspMI TstI Tth111I XbaI XcmI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769