Sequence for a region of YOR331C

BLAST search | FASTA search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

YOR331C on chromosome XV from coordinates 944119 to 943562.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

This is the genomic DNA sequence and may contain untranslated regions or bases (e. g. introns, or the site of a programmed translational frameshift). For a version of the sequence that does not contain these untranslated sequence region(s), please go back and select the coding sequence option.

Other Formats Available: GCG

>YOR331C  Chr 15  
ATGTCGTCCTTCATCGACTCGATTAAATCGACGTCTCTTTCAAGAGCCTTGACAATCGCC
TTAGGTTCCAACAACTTCAAAAGTGCCTCCACGATCAATGATTGCAAAATGGGCTTGTAC
TCGTCCCGGTTGTTGGCAATTCCTGACAACTTTTCCTTGGTTTCCTCGAATATCCCGTCT
AGCGACTGTTCACGAGCAGAAAGAACCTTCAACCTCATTTTGTTTGCTATCGTTGACTTA
GTAATCTGTTGCGAAAGCATGGCCTTCTTCAACTTGCTCTTGAAGTTGCCGTCAATGTTG
TTGGTTTCATTTCTTACGATGTTGGTCTTCTCGATTTCGTACTCTTGGTCAGCCTTCAAT
TGGATTTCCTTCGCTTTTTCTTCAGCTTCCTTTCTGATGAAAGCTTGCATCTTGTTCAAT
TCATCGTTCACTTGGTTTGGTGTCAAAGCAGTAATAGCGGAGGACATGCTGTATCGGATG
GTGCGTGGCCTGTTCTGTGCCTCTTTTGTAAAACAGTTACAAACAACTTTTCTTGCAACT
GCTATTGTTCTTTGCTGA

Return to SGD

SGD^tm pages Database Copyright © 1997-2010 The Board of Trustees of Leland Stanford Junior University. Permission to use the information contained in this database was given by the researchers/institutes who contributed or published the information. Users of the database are solely responsible for compliance with any copyright restrictions, including those applying to the author abstracts. Documents from this server are provided "AS-IS" without any warranty, expressed or implied. The SGD project at Stanford University is supported by a Genome Research Resource Grant from the US National Human Genome Research Institute, part of the US National Institutes of Health.