Restriction Map of MKK1/YOR231W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

MKK1/YOR231W on chromosome XV from coordinates 772601 to 774127.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.24003

Tsp4CI* TfiI | TspRI HinfI CviJI | | Hpy188I | AlwNI CviRI* MaeI MseI \ \ \ \ \ \ \ \ \ ATGGCTTCACTGTTCAGACCCCCAGAATCTGCGAAATGCAACCCAAACTCTCCTAGACTT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCGAAGTGACAAGTCTGGGGGTCTTAGACGCTTTACGTTGGGTTTGAGAGGATCTGAA // / / / / / / || | Hpy188I | HinfI CviRI* MaeI || Tsp4CI* | TfiI |TspRI AlwNI CviJI M A S L F R P P E S A K C N P N S P R L W L H C S D P Q N L R N A T Q T L L D L G F T V Q T P R I C E M Q P K L S * T * ----:----|----:----|----:----|----:----|----:----|----:----| X A E S N L G G S D A F H L G F E G L S X P K V T * V G L I Q S I C G L S E * V H S * Q E S G W F R R F A V W V R R S K TspDTI | AcyI | MaeII | |ZraI | || TaqI | || SetI | || TaiI | || AatII MnlI SetI | || | Hpy99I \ \ \ \\ \ \ AAACTGCCCCTCTTACGAAATAATCAGGTAGATGAAAATAATATATACTTGACGTCGAAT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGACGGGGAGAATGCTTTATTAGTCCATCTACTTTTATTATATATGAACTGCAGCTTA / / / / //// / MseI MnlI SetI | |||| TaqI | |||MaeII | |||AcyI | ||ZraI | |Hpy99I | AatII | TaiI | SetI TspDTI K L P L L R N N Q V D E N N I Y L T S N N C P S Y E I I R * M K I I Y T * R R M T A P L T K * S G R * K * Y I L D V E W ----:----|----:----|----:----|----:----|----:----|----:----| L S G R K R F L * T S S F L I Y K V D F * V A G R V F Y D P L H F Y Y I S S T S F Q G E * S I I L Y I F I I Y V Q R R I AluI CviJI | SetI Ksp632I* | | Tsp4CI* TsoI TspRI | MnlI | | | CviJI |MboII | SetI | |TaqI \ \ \ \ \\ \ \ \ \\ GGGAGTTCCACCACAGCTTACAGTAGCCACACCCCAGAACCACTGACCTCTTCCACATCG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CCCTCAAGGTGGTGTCGAATGTCATCGGTGTGGGGTCTTGGTGACTGGAGAAGGTGTAGC / / / / / / / // / | | | CviJI | | SetI || TaqI | | Tsp4CI* | MboII || AjuI | CviJI TspRI |Ksp632I* | AluI TsoI MnlI SetI G S S T T A Y S S H T P E P L T S S T S G V P P Q L T V A T P Q N H * P L P H R E F H H S L Q * P H P R T T D L F H I D ----:----|----:----|----:----|----:----|----:----|----:----| P L E V V A * L L W V G S G S V E E V D H S N W W L K C Y G C G L V V S R K W M P T G G C S V T A V G W F W Q G R G C R BseGI | MlyI Ksp632I* | PleI | MseI | |MaeI | |AhaIII* FokI | |MboII | || BsgI | TspDTI | || HinfI | || | Ksp632I* AjuI | | TaqI | || | AjuI | || | |MnlI \ \ \ \ \ \\ \ \ \ \\ \ \\ ACACTTTTCTCCCAAACTCGACTTCATCCTAGCGACTCTTCAATGACTTTAAATACAATG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TGTGAAAAGAGGGTTTGAGCTGAAGTAGGATCGCTGAGAAGTTACTGAAATTTATGTTAC / / / / // // / / // / / | FokI | BseGI || |AjuI HinfI | || | MnlI TspDTI TaqI || MaeI | || BsgI |PleI | |MseI MboII | AhaIII* MlyI Ksp632I* T L F S Q T R L H P S D S S M T L N T M H F S P K L D F I L A T L Q * L * I Q * T F L P N S T S S * R L F N D F K Y N E ----:----|----:----|----:----|----:----|----:----|----:----| V S K E W V R S * G L S E E I V K F V I S V K R G F E V E D * R S K L S K L Y L C K E G L S S K M R A V R * H S * I C H BccI StuI | SetI CviJI | | DdeI HaeIII | | EspI* | Cac8I | | | Hin4II* | |MboII | | | | ApoI | ||CviRI* | | | | TspEI | ||TspDTI | | | | | BspCNI | ||| MwoI | | | | | |BseMII | ||| MboII | | | | | || Tsp4CI* | ||| |AciI | | | | | || | DdeI CviRI* \ \\\ \\ \ \ \ \ \ \\ \ \ \ AAGAAGAGGCCTGCACCGCCATCTTTACCTTCGCTCAGCATAAATTCACAGTCTAAGTGC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTCTCCGGACGTGGCGGTAGAAATGGAAGCGAGTCGTATTTAAGTGTCAGATTCACG / / //// / / / / // / / / | | |||| AciI | BccI Hin4II* || | | CviRI* | | |||MboII SetI EspI* || | DdeI | | ||CviRI* DdeI || Tsp4CI* | | |MwoI |BseMII | | TspDTI |TspEI | | MboII |ApoI | | Cac8I BspCNI | HaeIII | CviJI | StuI Ksp632I* K K R P A P P S L P S L S I N S Q S K C R R G L H R H L Y L R S A * I H S L S A E E A C T A I F T F A Q H K F T V * V Q ----:----|----:----|----:----|----:----|----:----|----:----| F F L G A G G D K G E S L M F E C D L H S S S A Q V A M K V K A * C L N V T * T L L P R C R W R * R R E A Y I * L R L A Hpy188I | Hpy166II | | FatI Csp6I BccI | | |CviAII BtgZI |RsaI | BccI | | || NlaIII \ \\ \ \ \ \ \\ \ AAAACACTACCCGAACTCGTACCCATCGCCGATGTGTCTGATGGTAAACATGATTTAGGA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTGTGATGGGCTTGAGCATGGGTAGCGGCTACACAGACTACCATTTGTACTAAATCCT / // / / / / / // BtgZI |Csp6I | | Hpy188I | | |FatI RsaI | BccI | | CviAII BccI | NlaIII Hpy166II K T L P E L V P I A D V S D G K H D L G K H Y P N S Y P S P M C L M V N M I * D N T T R T R T H R R C V * W * T * F R I ----:----|----:----|----:----|----:----|----:----|----:----| L V S G S S T G M A S T D S P L C S K P C F V V R V R V W R R H T Q H Y V H N L F C * G F E Y G D G I H R I T F M I * S MaeIII Tsp45I | TspDTI CviJI | | MseI BccI \ \ \ \ \ TTGAAACAGCGTGTGATAGCCGAAAATGAGTTGTCTGGTAATAGTGACTTAACCCCTTCA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTTGTCGCACACTATCGGCTTTTACTCAACAGACCATTATCACTGAATTGGGGAAGT / / / / / CviJI | | MseI BccI | Tsp45I | MaeIII TspDTI L K Q R V I A E N E L S G N S D L T P S * N S V * * P K M S C L V I V T * P L H E T A C D S R K * V V W * * * L N P F I ----:----|----:----|----:----|----:----|----:----|----:----| N F C R T I A S F S N D P L L S K V G E I S V A H S L R F H T T Q Y Y H S L G K Q F L T H Y G F I L Q R T I T V * G R * Ksp632I* | MnlI | | DdeI | | |SetI | | || BseMII | | || Hpy188I | | || |BspCNI | | || ||BsaXI | | || ||| TstI | | || ||| |MboI | | || ||| ||MnlI | | || ||| |||DpnI TaqI | | || ||| ||||BstKTI ClaI | | || ||| |||||DdeI | Hin4II* TstI | | || ||| ||||||BspCNI | | Cac8I BsaXI | | || ||| ||||||Hpy188I | | | CviJI | MboII SetI | | || ||| |||||||BseMII \ \ \ \ \ \ \ \ \ \\ \\\ \\\\\\\\ TCGATGGCAAGCCCCTTTTCACATACAAACACCTCTTCTCCCTACCTCAGAAATGATCTG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AGCTACCGTTCGGGGAAAAGTGTATGTTTGTGGAGAAGAGGGATGGAGTCTTTACTAGAC // / / / / / / /// /// ///// || | | | BsaXI | SetI ||| ||DdeI ||||Hpy188I || | | TstI MboII ||| || ||||BseMII || | CviJI ||| || ||||MboI || Cac8I ||| || |||BspCNI |Hin4II* ||| || ||DpnI ClaI ||| || |BstKTI TaqI ||| || MnlI ||| |Hpy188I ||| |BspCNI ||| |BsaXI ||| |TstI ||| BseMII ||SetI |Ksp632I* MnlI S M A S P F S H T N T S S P Y L R N D L R W Q A P F H I Q T P L L P T S E M I * D G K P L F T Y K H L F S L P Q K * S E ----:----|----:----|----:----|----:----|----:----|----:----| D I A L G K E C V F V E E G * R L F S R M S P L G R K V Y L C R K E R G * F H D R H C A G K * M C V G R R G V E S I I Q MboI XhoII |TspRI ||DpnI |||BstKTI |||| Hpy188I ApoI NdeI TspDTI TspEI |||| | BinI* TspEI EcoRV | BslFI |BslFI \ \\\\ \ \ \ \ \ \ \\ AGCAATTCAGTGGGATCTGACTTTTCAAATTTGATATCGGCATATGAACAAAGTTCAAGT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TCGTTAAGTCACCCTAGACTGAAAAGTTTAAACTATAGCCGTATACTTGTTTCAAGTTCA / / / // / / / / / / / | | TspEI || | BinI* | EcoRV | BslFI TspDTI | TspRI || Hpy188I TspEI NdeI DdeI || XhoII ApoI || MboI |DpnI BstKTI S N S V G S D F S N L I S A Y E Q S S S A I Q W D L T F Q I * Y R H M N K V Q V Q F S G I * L F K F D I G I * T K F K S ----:----|----:----|----:----|----:----|----:----|----:----| L L E T P D S K E F K I D A Y S C L E L S C N L P I Q S K L N S I P M H V F N L A I * H S R V K * I Q Y R C I F L T * T Hpy188I BseYI |TfiI | GsaI |HinfI | CviJI || Csp6I BccI | | MboII || |RsaI MseI Tsp4CI* \ \ \ \ \\ \\ \ \ CCCATCAAGTCATCGTCCCAGCCTAAATCATCTTCTGAATCGTACATAGACTTAAACAGT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GGGTAGTTCAGTAGCAGGGTCGGATTTAGTAGAAGACTTAGCATGTATCTGAATTTGTCA / / / // / / // / / BslFI BccI | |MboII | | |Csp6I | Tsp4CI* | BseYI | | RsaI TspRI | CviJI | HinfI MseI GsaI | TfiI Hpy188I P I K S S S Q P K S S S E S Y I D L N S P S S H R P S L N H L L N R T * T * T V H Q V I V P A * I I F * I V H R L K Q C ----:----|----:----|----:----|----:----|----:----|----:----| G M L D D D W G L D D E S D Y M S K F L D W * T M T G A * I M K Q I T C L S L C G D L * R G L R F * R R F R V Y V * V T BsaBI |MboI FokI |BclI | TspDTI ||MmeI | | CviRI* Csp6I |||DpnI | | | ApoI Hpy166II ||||BstKTI | | | TspEI |RsaI |||||MfeI | | | | MseI BsmAI ||TspRI |||||TspEI BseGI | | | | |AhaIII* |MboI \\\ \\\\\\ \ \ \ \ \ \\ \\ GTACGAGATGTTGATCAATTGGATGAAAATGGTTGGAAATATGCAAATTTAAAAGATAGG 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CATGCTCTACAACTAGTTAACCTACTTTTACCAACCTTTATACGTTTAAATTTTCTATCC /// / // / / / / / / /// / ||Csp6I | || | | BseGI | FokI | ||MseI BstKTI |RsaI | || | TspEI TspDTI | |AhaIII* Hpy166II | || | MfeI | TspEI | || BclI | ApoI | || MboI CviRI* | |DpnI | BstKTI BsaBI MmeI V R D V D Q L D E N G W K Y A N L K D R Y E M L I N W M K M V G N M Q I * K I G T R C * S I G * K W L E I C K F K R * D ----:----|----:----|----:----|----:----|----:----|----:----| T R S T S * N S S F P Q F Y A F K F S L H V L H Q D I P H F H N S I H L N L L Y Y S I N I L Q I F I T P F I C I * F I P DpnI |TaqI NlaIV |BstKTI |CviJI ||Hpy178III* MaeI |Cfr10I ||| BinI* BsmI Hin4II* ||HpaII CviJI TspEI \\\ \ \ \ \\\ \ \ ATCGAGACATTAGGCATTCTAGGAGAAGGAGCCGGTGGCTCTGTTTCCAAGTGTAAATTG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TAGCTCTGTAATCCGTAAGATCCTCTTCCTCGGCCACCGAGACAAAGGTTCACATTTAAC ///// / / / / // // / / ||||| | BsmI | MaeI || || CviJI TspEI ||||| BinI* Hin4II* || |Cfr10I ||||Hpy178III* || HpaII |||TaqI |CviJI ||MboI NlaIV |BsmAI DpnI I E T L G I L G E G A G G S V S K C K L S R H * A F * E K E P V A L F P S V N * R D I R H S R R R S R W L C F Q V * I E ----:----|----:----|----:----|----:----|----:----|----:----| I S V N P M R P S P A P P E T E L H L N S R S M L C E L L L L R H S Q K W T Y I D L C * A N * S F S G T A R N G L T F Q MseI | BinI* | | MboI | | XhoII MboI | | | DpnI | DpnI | | | |BstKTI | |BstKTI | | | ||AvaI | || BinI* MseI | | | ||Hpy178III* | || | SspI |AhaIII* | | | |||BmeT110I \ \\ \ \ \\ \ \ \ \\\\ AAAAATGGATCAAAAATATTCGCTTTAAAAGTGATAAACACATTAAATACAGATCCCGAG 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTACCTAGTTTTTATAAGCGAAATTTTCACTATTTGTGTAATTTATGTCTAGGGCTC // / // // / / // / /// || MboI |SspI |MseI | | || | ||AvaI |DpnI BinI* AhaIII* | | || | |BmeT110I BstKTI | | || | Hpy178III* | | || XhoII | | || MboI | | |DpnI | | BstKTI | BinI* MseI K N G S K I F A L K V I N T L N T D P E K M D Q K Y S L * K * * T H * I Q I P S K W I K N I R F K S D K H I K Y R S R V ----:----|----:----|----:----|----:----|----:----|----:----| F F P D F I N A K F T I F V N F V S G S S F H I L F I R K L L S L C M L Y L D R F I S * F Y E S * F H Y V C * I C I G L Hpy188I Tsp4CI* Hpy188I SspI | TspEI | MseI Hpy188I SplI* \ \ \ \ \ \ \ \ TATCAGAAGCAAATATTCAGAGAATTACAGTTTAATAGGAGTTTCCAATCCGAATATATC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| ATAGTCTTCGTTTATAAGTCTCTTAATGTCAAATTATCCTCAAAGGTTAGGCTTATATAG / / / / / / / Hpy188I | Hpy188I | | MseI Hpy188I SspI | Tsp4CI* TspEI Y Q K Q I F R E L Q F N R S F Q S E Y I I R S K Y S E N Y S L I G V S N P N I S S E A N I Q R I T V * * E F P I R I Y R ----:----|----:----|----:----|----:----|----:----|----:----| Y * F C I N L S N C N L L L K W D S Y I T D S A F I * L I V T * Y S N G I R I Y I L L L Y E S F * L K I P T E L G F I D Hin4I FokI | TaqII TspGWI | | MmeI Csp6I Hin4I MboII | TspEI | | TatI |RsaI |Hpy166II |BseGI | |Ksp632I* | | |Csp6I \\ \\ \\ \ \\ \ \ \\ GTACGATATTATGGAATGTTTACGGATGACGAAAACTCTTCAATTTATATTGCTATGGAG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CATGCTATAATACCTTACAAATGCCTACTGCTTTTGAGAAGTTAAATATAACGATACCTC /// / / / / / // / / ||SplI* Hin4I | BseGI | | |Hin4I | MmeI |Csp6I | MboII | | | TaqII RsaI Hpy166II | | Ksp632I* | | TspEI | FokI TspGWI V R Y Y G M F T D D E N S S I Y I A M E Y D I M E C L R M T K T L Q F I L L W S T I L W N V Y G * R K L F N L Y C Y G V ----:----|----:----|----:----|----:----|----:----|----:----| T R Y * P I N V S S S F E E I * I A I S R V I N H F T * P H R F S K L K Y Q * P Y S I I S H K R I V F V R * N I N S H L RsaI |FatI ||CviAII ||| NlaIII ||| | SfaNI ||| | |MboI BseGI ||| | || DpnI | PsiI ||| | || |PvuI | | FokI ||| | || |McrI* | | | ApoI ||| | || |BstKTI | | | TspEI MboI \\\ \ \\ \\ \ \ \ \ \ TACATGGGTGGGCGATCGTTGGATGCTATTTATAAAAATTTGTTAGAGCGTGGTGGTAGG 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTACCCACCCGCTAGCAACCTACGATAAATATTTTTAAACAATCTCGCACCACCATCC /// // //// / / / / / ||| |FatI |||MboI BseGI PsiI | TspEI BstKTI ||| CviAII ||SfaNI | ApoI TspRI ||TatI |DpnI FokI |NlaIII BstKTI |Csp6I McrI* RsaI PvuI Y M G G R S L D A I Y K N L L E R G G R T W V G D R W M L F I K I C * S V V V G H G W A I V G C Y L * K F V R A W W * D ----:----|----:----|----:----|----:----|----:----|----:----| Y M P P R D N S A I * L F K N S R P P L T C P H A I T P H * K Y F N T L A H H Y V H T P S R Q I S N I F I Q * L T T T P DpnI |BstKTI || BinI* CviRI* || | TspRI | MboII || | | BssKI | |AciI || | | EcoRII | || MnlI || | | |SecI* | || Csp6I || | | ||ScrFI | || |RsaI FatI || | | ||BseBI | || || DdeI CviRI* \\ \ \ \\\ \ \\ \\ \ \ ATCAGTGAAAAAGTCCTGGGGAAGATTGCAGAAGCGGTACTAAGAGGACTATCATATTTG 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTCACTTTTTCAGGACCCCTTCTAACGTCTTCGCCATGATTCTCCTGATAGTATAAAC / / / / / / / / // / / | MboI BinI* | EcoRII | | | || DdeI CviRI* DpnI | BssKI | | | |Csp6I NlaIII | SecI* | | | RsaI BseBI | | AciI ScrFI | | MnlI | MboII CviRI* I S E K V L G K I A E A V L R G L S Y L S V K K S W G R L Q K R Y * E D Y H I C Q * K S P G E D C R S G T K R T I I F A ----:----|----:----|----:----|----:----|----:----|----:----| I L S F T R P F I A S A T S L P S D Y K S * H F L G P S S Q L L P V L L V I M N D T F F D Q P L N C F R Y * S S * * I Q CviAII SspI | NlaIII MseI |BdaI | | TspDTI TspDTI | CviJI |BdaI \ \ \ \ \ \ \\ CATGAAAAAAAAGTTATTCATAGAGATATTAAGCCCCAGAATATTTTACTGAATGAAAAT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| GTACTTTTTTTTCAATAAGTATCTCTATAATTCGGGGTCTTATAAAATGACTTACTTTTA /// / / / // ||TspDTI TspDTI | CviJI |SspI |FatI MseI BdaI CviAII BdaI H E K K V I H R D I K P Q N I L L N E N M K K K L F I E I L S P R I F Y * M K M * K K S Y S * R Y * A P E Y F T E * K W ----:----|----:----|----:----|----:----|----:----|----:----| C S F F T I * L S I L G W F I K S F S F A H F F L * E Y L Y * A G S Y K V S H F M F F F N N M S I N L G L I N * Q I F I TspRI | CviJI | | MseI | | |HpaI | | |HindII | | |Hpy166II | | || NheI | | || |MaeI | | || ||Cac8I BdaI | | || ||| BmtI SetI BdaI BceAI | | || ||| CviJI TspDTI |HphI |BsaXI | | || ||| |BsaXI \ \\ \\ \ \ \\ \\\ \\ GGTCAGGTGAAACTTTGTGATTTTGGGGTCAGTGGAGAAGCCGTTAACTCGCTAGCCACA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CCAGTCCACTTTGAAACACTAAAACCCCAGTCACCTCTTCGGCAATTGAGCGATCGGTGT / / / / / / / // / /// | TspDTI | HphI | TspRI | |MseI | ||CviJI SetI BdaI | BceAI | | | ||NheI BdaI BsaXI | | | |MaeI | | | BsaXI | | | Cac8I | | BmtI | Hpy166II | HindII | HpaI CviJI G Q V K L C D F G V S G E A V N S L A T V R * N F V I L G S V E K P L T R * P Q S G E T L * F W G Q W R S R * L A S H N ----:----|----:----|----:----|----:----|----:----|----:----| P * T F S Q S K P T L P S A T L E S A V H D P S V K H N Q P * H L L R * S A L W T L H F K T I K P D T S F G N V R * G C TsoI BslFI | AcyI | CviJI | MaeII | |NlaIV | |GsuI | ||Hin4I | |ZraI | ||Hin4I | |Eco57MI | |||Hpy178III* | || SetI | |||| XmnI SetI Tsp4CI* | || TaiI | |||| |TfiI |HindII | MaeIII | || AatII | |||| |HinfI |Hpy166II | Tsp45I \ \\ \ \ \\\\ \\ \\ \ \ ACATTCACGGGGACGTCATTCTATATGGCTCCAGAAAGGATTCAAGGTCAACCATACAGT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TGTAAGTGCCCCTGCAGTAAGATATACCGAGGTCTTTCCTAAGTTCCAGTTGGTATGTCA / / // / // / / / / / / // TsoI | |MaeII | || | | | SetI | | |Tsp4CI* | |AcyI | || | | HinfI | | |Hin4I | ZraI | || | | TfiI | | |Hin4I Eco57MI | || | XmnI | | Hin4I AatII | || Hpy178III* | | Hin4I TaiI | |NlaIV | TspRI SetI | BslFI Hpy166II GsuI | CviJI HindII Hin4I Hin4I T F T G T S F Y M A P E R I Q G Q P Y S H S R G R H S I W L Q K G F K V N H T V I H G D V I L Y G S R K D S R S T I Q C ----:----|----:----|----:----|----:----|----:----|----:----| V N V P V D N * I A G S L I * P * G Y L L M * P S T M R Y P E L F S E L D V M C C E R P R * E I H S W F P N L T L W V T Hin4I Hin4I |Hin4I ApoI |Hin4I MaeIII Hin4I TspEI ||TspRI Hpy188I Tsp45I MseI Hin4I | MboII \\\ \ \ \ \ \ \ GTCACATCTGATGTATGGTCACTTGGATTAACGATTTTGGAAGTGGCGAACGGGAAATTT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTGTAGACTACATACCAGTGAACCTAATTGCTAAAACCTTCACCGCTTGCCCTTTAAA / / / / / // | Hpy188I | | MseI |TspEI Tsp45I | Hin4I |ApoI MaeIII | Hin4I MboII Tsp45I MaeIII V T S D V W S L G L T I L E V A N G K F S H L M Y G H L D * R F W K W R T G N F H I * C M V T W I N D F G S G E R E I S ----:----|----:----|----:----|----:----|----:----|----:----| T V D S T H D S P N V I K S T A F P F N H * M Q H I T V Q I L S K P L P S R S I D C R I Y P * K S * R N Q F H R V P F K TseI |BisI ||BlsI |||CviJI |||| MboII |||| | MwoI BccI |||| | | AluI FatI SapI |||| | | BbvI |CviAII Hpy188I |||| | | CviJI || NlaIII Ksp632I* |||| | | | SetI TspEI MseI BsaXI \\ \ \ \\\\ \ \ \ \ \ \ \ CCATGCTCTTCCGAGAAGATGGCAGCCAATATAGCTCCCTTTGAATTGTTAATGTGGATT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| GGTACGAGAAGGCTCTTCTACCGTCGGTTATATCGAGGGAAACTTAACAATTACACCTAA / // / / / //// / / / / / / | |FatI | | | |||| | | | BbvI | BsaXI | CviAII | | | |||| | | CviJI | MseI NlaIII | | | |||| | | AluI TspEI | | | |||| | SetI | | | |||| MwoI | | | |||MboII | | | ||CviJI | | | ||TseI | | | |BisI | | | BlsI | | Ksp632I* | | SapI | BccI Hpy188I P C S S E K M A A N I A P F E L L M W I H A L P R R W Q P I * L P L N C * C G F M L F R E D G S Q Y S S L * I V N V D F ----:----|----:----|----:----|----:----|----:----|----:----| G H E E S F I A A L I A G K S N N I H I E M S K R S S P L W Y L E R Q I T L T S W A R G L L H C G I Y S G K F Q * H P N BseGI | TfiI | HinfI Hpy178III* | | FokI | TspEI | | | TspDTI PleI MseI | | MseI BsaXI | | | | NdeI HinfI |MlyI \ \ \ \ \ \ \ \ \ \ \ \\ TTAACATTTACTCCTGAATTAAAGGATGAACCCGAATCTAATATCATATGGAGTCCATCA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| AATTGTAAATGAGGACTTAATTTCCTACTTGGGCTTAGATTATAGTATACCTCAGGTAGT / / // / / / / / / / MseI | |BsaXI BseGI | | FokI NdeI HinfI PleI | |MseI | TspDTI MlyI | TspEI HinfI Hpy178III* TfiI L T F T P E L K D E P E S N I I W S P S * H L L L N * R M N P N L I S Y G V H H N I Y S * I K G * T R I * Y H M E S I I ----:----|----:----|----:----|----:----|----:----|----:----| K V N V G S N F S S G S D L I M H L G D K L M * E Q I L P H V R I * Y * I S D M * C K S R F * L I F G F R I D Y P T W * Hpy178III* | Hpy166II | | CfrI | | | CviJI BccI PshAI | | | HaeIII Hin4I | Tsp4CI* | | | | Hin4I Hin4I BccI TaqI | | Hpy188I | | | | Hin4I | FokI \ \ \ \ \ \ \ \ \ \ \ \ TTCAAATCCTTTATCGACTACTGTCTGAAAAAAGATAGTCGTGAACGGCCATCTCCAAGA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTTTAGGAAATAGCTGATGACAGACTTTTTTCTATCAGCACTTGCCGGTAGAGGTTCT / / // / // / / / / / BccI | || Hpy188I || | | | Hin4I BccI | |Tsp4CI* || | | | Hin4I | PshAI || | | CfrI TaqI || | HaeIII || | CviJI || Hin4I || Hin4I |Hpy166II Hpy178III* F K S F I D Y C L K K D S R E R P S P R S N P L S T T V * K K I V V N G H L Q D Q I L Y R L L S E K R * S * T A I S K T ----:----|----:----|----:----|----:----|----:----|----:----| N L D K I S * Q R F F S L R S R G D G L M * I R * R S S D S F L Y D H V A M E L E F G K D V V T Q F F I T T F P W R W S BceAI | MboI | BclI | | DpnI | | |BstKTI | | || Hin4I | | || Hin4I | | || BseGI Hin4I ApoI | | || | StyI Hin4I Hin4I Hin4I TspEI | | || | SecI* Hin4I Hin4I | TspDTI |MnlI \ \ \\ \ \ \ \ \ \ \\ CAAATGATCAATCATCCTTGGATAAAGGGTCAAATGAAAAAAAATGTCAATATGGAAAAA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTACTAGTTAGTAGGAACCTATTTCCCAGTTTACTTTTTTTTACAGTTATACCTTTTT / // // / / / / / / | || |BseGI | | Hin4I Hin4I TspDTI MnlI | || BclI | | Hin4I Hin4I | || MboI | SecI* | |Hin4I | StyI | |Hin4I Hin4I | |DpnI Hin4I | BstKTI BceAI FokI Q M I N H P W I K G Q M K K N V N M E K K * S I I L G * R V K * K K M S I W K N N D Q S S L D K G S N E K K C Q Y G K I ----:----|----:----|----:----|----:----|----:----|----:----| C I I L * G Q I F P * I F F F T L I S F V F S * D D K S L P D F S F F H * Y P F L H D I M R P Y L T L H F F I D I H F F Hpy178III* MseI \ \ TTCGTGAGGAAGTGCTGGAAAGATTAA 1510 1520 ----:----|----:----|----:-- AAGCACTCCTTCACGACCTTTCTAATT / / / | Hpy178III* MseI TspEI ApoI F V R K C W K D * S * G S A G K I X R E E V L E R L X ----:----|----:----|----:-- N T L F H Q F S * I R S S T S S L N E H P L A P F I L # Enzymes that cut Frequency Isoschizomers AatII 2 AciI 2 BspACI,SsiI AcyI 2 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AhaIII* 3 DraI AjuI 1 AluI 2 AluBI AlwNI 1 CaiI ApoI 6 AcsI,XapI AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I BbvI 1 BseXI,BstV1I,Lsp1109I BccI 8 BceAI 2 BclI 2 FbaI,Ksp22I BdaI 2 BinI* 5 AlwI,BspPI,AclWI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmeT110I 1 BmtI 1 BspOI BsaBI 1 Bse8I,BseJI BsaXI 3 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 6 BstF5I,BtsCI BseMII 3 BseYI 1 BsgI 1 BslFI 3 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI BspCNI 3 BssKI 1 BstSCI,StyD4I BstKTI 9 BtgZI 1 Cac8I 3 BstC8I Cfr10I 1 BsrFI,BssAI,Bse118I CfrI 1 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 6 CviQI,RsaNI CviAII 4 CviJI 16 CviKI-1 CviRI* 6 HpyCH4V DdeI 5 BstDEI,HpyF3I DpnI 9 MalI Eco57MI 1 EcoRII 1 AjnI,Psp6I,PspGI EcoRV 1 Eco32I EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FatI 4 FokI 6 GsaI 1 GsuI 1 BpmI HaeIII 2 BsnI,BsuRI,BshFI,PhoI Hin4I 11 Hin4II* 3 HpyAV HindII 2 HincII HinfI 6 HpaI 1 KspAI HpaII 1 HapII,BsiSI,MspI HphI 1 AsuHPI Hpy166II 6 Hpy8I Hpy178III* 6 Hpy188III Hpy188I 12 Hpy99I 1 Ksp632I* 6 Eam1104I,EarI,Bst6I MaeI 4 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 3 MboI 9 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 10 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 1 MunI MlyI 2 SchI MmeI 2 MnlI 7 MseI 15 Tru1I,Tru9I MwoI 2 HpyF10VI,BstMWI NdeI 2 FauNDI NheI 1 AsuNHI NlaIII 4 Hin1II,Hsp92II,FaeI NlaIV 2 BspLI,BmiI,PspN4I PleI 2 PpsI PshAI 1 BstPAI,BoxI PsiI 1 AanI PvuI 1 MvrI,Ple19I,BpvUI RsaI 6 AfaI SapI 1 LguI,PciSI,BspQI ScrFI 1 BmrFI,MspR9I,Bme1390I SecI* 2 BseDI,BssECI,BsaJI SetI 11 SfaNI 1 LweI SplI* 1 Pfl23II,PspLI,BsiWI SspI 3 StuI 1 Eco147I,PceI,SseBI,AatI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 2 TaqI 6 TaqII 1 TatI 1 TfiI 4 PfeI TseI 1 ApeKI TsoI 2 Tsp45I 3 NmuCI Tsp4CI* 7 HpyCH4III,TaaI,Bst4CI TspDTI 11 TspEI 13 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 7 TscAI TstI 1 XhoII 2 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I ZraI 2 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AbsI Acc65I AccI AclI AflII AflIII AgeI AlfI AloI ApaI ApaLI AscI Asp718I AsuI* AsuII AvaII AvrII BaeI BalI BamHI BarI BbvCI BbvII* Bce83I* BcgI BciVI BetI* BfiI BglI BglII BmgT120I BplI Bpu10I BsaAI BsePI BseRI BseSI BsiI* BsiYI* Bsp120I Bsp1407I BspHI BspLU11I* BspMI BspMII* BsrBI BsrDI BsrI BssNAI Bst1107I BstAPI BstEII BstXI BstZ17I BtrI BtsI CauII* Cfr9I CspCI DinI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I EcoICRI EcoNI EcoP15I EcoRI EcoT22I EgeI EheI Esp3I FalI FauI FnuDII* FseI FspAI GlaI HaeII HgaI HgiAI* HgiCI* HgiJII* HhaI Hin6I HindIII HinP1I HspAI KasI KpnI MauBI MluI Mph1103I MroNI MslI MstI* NaeI NarI NcoI NgoMIV NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PspOMI PspXI PsrI PstI PvuII RsrII SacI SacII SalI SanDI SauI* ScaI SduI SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SrfI Sse232I* Sse8387I SwaI TauI TspMI Tth111I VspI XbaI XcmI XhoI XmaCI XmaI XmaIII* Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769