Restriction Map of ADE2/YOR128C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

ADE2/YOR128C on chromosome XV from coordinates 566191 to 564476.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.21198

EMBOSS_001 TfiI HinfI | XbaI MaeII | |MaeI | BslFI | |Hpy178III* | |SetI | || Tsp4CI* MfeI | |TaiI | || | MnlI TspEI | || MnlI BslFI \ \\ \ \ \ \ \\ \ \ ATGGATTCTAGAACAGTTGGTATATTAGGAGGGGGACAATTGGGACGTATGATTGTTGAG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTAAGATCTTGTCAACCATATAATCCTCCCCCTGTTAACCCTGCATACTAACAACTC / // / / / / / // / | || | MnlI | | | |BslFI BslFI | || Tsp4CI* | | | MnlI | |XbaI | | MaeII | Hpy178III* | TaiI | MaeI | SetI HinfI TspEI TfiI MfeI M D S R T V G I L G G G Q L G R M I V E W I L E Q L V Y * E G D N W D V * L L R G F * N S W Y I R R G T I G T Y D C * G ----:----|----:----|----:----|----:----|----:----|----:----| X S E L V T P I N P P P C N P R I I T S X P N * F L Q Y I L L P V I P V Y S Q Q H I R S C N T Y * S P S L Q S T H N N L TseI SfaNI |BisI CviJI Tsp4CI* ApoI ||BlsI |BbvI MseI | MaeI TspEI \\\ \\ \ \ \ \ GCAGCAAACAGGCTCAACATTAAGACGGTAATACTAGATGCTGAAAATTCTCCTGCCAAA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CGTCGTTTGTCCGAGTTGTAATTCTGCCATTATGATCTACGACTTTTAAGAGGACGGTTT /// / / / / / / / ||TseI | BbvI | | | MaeI TspEI |BisI CviJI | | SfaNI ApoI BlsI | Tsp4CI* MseI A A N R L N I K T V I L D A E N S P A K Q Q T G S T L R R * Y * M L K I L L P N S K Q A Q H * D G N T R C * K F S C Q T ----:----|----:----|----:----|----:----|----:----|----:----| A A F L S L M L V T I S S A S F E G A L P L L C A * C * S P L V L H Q F N E Q W C C V P E V N L R Y Y * I S F I R R G F MaeII | MseI | SetI | TaiI | MslI Hpy178III* | | BstXI | EcoRV | | | CviJI | | TaqI | | | |NlaIV | | MnlI \ \ \ \\ \ \ \ CAAATAAGCAACTCCAATGACCACGTTAATGGCTCCTTTTCCAATCCTCTTGATATCGAA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTATTCGTTGAGGTTACTGGTGCAATTACCGAGGAAAAGGTTAGGAGAACTATAGCTT / /// / // / // / | ||| | |NlaIV | || TaqI | ||| | CviJI | |MnlI | ||| MseI | EcoRV | ||MslI Hpy178III* | |MaeII | BstXI TaiI SetI Q I S N S N D H V N G S F S N P L D I E K * A T P M T T L M A P F P I L L I S K N K Q L Q * P R * W L L F Q S S * Y R K ----:----|----:----|----:----|----:----|----:----|----:----| C I L L E L S W T L P E K E L G R S I S V F L C S W H G R * H S R K W D E Q Y R L Y A V G I V V N I A G K G I R K I D F FatI MaeI |CviAII | AluI || NspI | CviJI || NlaIII | | SetI || |MslI \ \ \ \\ \\ AAACTAGCTGAAAAATGTGATGTGCTAACGATTGAGATTGAGCATGTTGATGTTCCTACA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGATCGACTTTTTACACTACACGATTGCTAACTCTAACTCGTACAACTACAAGGATGT /// / /// / ||CviJI | ||MslI MboII ||AluI | |FatI |MaeI | CviAII SetI NlaIII NspI K L A E K C D V L T I E I E H V D V P T N * L K N V M C * R L R L S M L M F L H T S * K M * C A N D * D * A C * C S Y T ----:----|----:----|----:----|----:----|----:----|----:----| F S A S F H S T S V I S I S C T S T G V F V L Q F I H H A L S Q S Q A H Q H E * F * S F F T I H * R N L N L M N I N R C TspEI | MseI MboII | |GsuI | TfiI | |Eco57MI | HinfI | || ApoI Hpy178III* | | FokI BseGI | || TspEI | Hin4II* \ \ \ \ \ \\ \ \ \ CTAAAGAATCTTCAAGTAAAACATCCCAAATTAAAAATTTACCCTTCTCCAGAAACAATC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GATTTCTTAGAAGTTCATTTTGTAGGGTTTAATTTTTAAATGGGAAGAGGTCTTTGTTAG / / / / // / // / | FokI BseGI | |MseI TspEI |Hin4II* Hpy188I HinfI | TspEI ApoI Hpy178III* TfiI Eco57MI GsuI L K N L Q V K H P K L K I Y P S P E T I * R I F K * N I P N * K F T L L Q K Q S K E S S S K T S Q I K N L P F S R N N Q ----:----|----:----|----:----|----:----|----:----|----:----| S F F R * T F C G L N F I * G E G S V I V L S D E L L V D W I L F K G K E L F L * L I K L Y F M G F * F N V R R W F C D Hpy188I MseI MaeIII \ \ \ AGATTGATACAAGACAAATATATTCAAAAAGAGCATTTAATCAAAAATGGTATAGCAGTT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TCTAACTATGTTCTGTTTATATAAGTTTTTCTCGTAAATTAGTTTTTACCATATCGTCAA / MseI R L I Q D K Y I Q K E H L I K N G I A V D * Y K T N I F K K S I * S K M V * Q L I D T R Q I Y S K R A F N Q K W Y S S Y ----:----|----:----|----:----|----:----|----:----|----:----| L N I C S L Y I * F S C K I L F P I A T * I S V L C I Y E F L A N L * F H Y L L S Q Y L V F I N L F L M * D F I T Y C N BslFI | Esp3I | BsmAI | CviJI | |BsrI | || MmeI | || | TspRI | || | |AcyI | || | |MaeII | || | ||ZraI | || | ||| SetI | || | ||| TaiI | || | ||| AatII Ksp632I* \ \\ \ \\\ \ \ ACCCAAAGTGTTCCTGTGGAACAAGCCAGTGAGACGTCCCTATTGAATGTTGGAAGAGAT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TGGGTTTCACAAGGACACCTTGTTCGGTCACTCTGCAGGGATAACTTACAACCTTCTCTA / // // / // / MaeIII || || | |MaeII Ksp632I* || || | |AcyI || || | ZraI || || AatII || || TaiI || || SetI || |BsmAI || |Esp3I || MmeI |CviJI |BslFI TspRI BsrI T Q S V P V E Q A S E T S L L N V G R D P K V F L W N K P V R R P Y * M L E E I P K C S C G T S Q * D V P I E C W K R F ----:----|----:----|----:----|----:----|----:----|----:----| V W L T G T S C A L S V D R N F T P L S * G F H E Q P V L W H S T G I S H Q F L G L T N R H F L G T L R G * Q I N S S I Hpy178III* Ksp632I* MaeIII MboII | MnlI TaqI BccI |MnlI | SetI MboII \ \ \ \ \ \\ \ \ \ TTGGGTTTTCCATTCGTCTTGAAGTCGAGGACTTTGGCATACGATGGAAGAGGTAACTTC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AACCCAAAAGGTAAGCAGAACTTCAGCTCCTGAAACCGTATGCTACCTTCTCCATTGAAG / // / / / / / // MboII || TaqI | | | SetI |MboII |Hpy178III* | | Ksp632I* MaeIII MnlI | MnlI BccI L G F P F V L K S R T L A Y D G R G N F W V F H S S * S R G L W H T M E E V T S G F S I R L E V E D F G I R W K R * L R ----:----|----:----|----:----|----:----|----:----|----:----| K P K G N T K F D L V K A Y S P L P L K N P N E M R R S T S S K P M R H F L Y S Q T K W E D Q L R P S Q C V I S S T V E XmnI |TfiI |HinfI || BetI* || BspMII* || |HpaII || |Hpy178III* TatI MboI || || HindIII Hin4II* | DpnI || || | AluI |Csp6I | |BstKTI || || | CviJI ||RsaI | || BinI* || || | | SetI ||ScaI | || | Csp6I \\ \\ \ \ \ \\\ \ \\ \ \ GTTGTAAAGAATAAGGAAATGATTCCGGAAGCTTTGGAAGTACTGAAGGATCGTCCTTTG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CAACATTTCTTATTCCTTTACTAAGGCCTTCGAAACCTTCATGACTTCCTAGCAGGAAAC / / /// / / / /// // / / | | ||| | | | ||TatI || MboI BinI* | | ||| | | | |Csp6I |DpnI | | ||| | | | ScaI BstKTI | | ||| | | | RsaI | | ||| | | Hin4II* | | ||| | HindIII | | ||| CviJI | | ||| AluI | | ||SetI | | |BspMII* | | |BetI* | | Hpy178III* | | HpaII | HinfI | TfiI XmnI V V K N K E M I P E A L E V L K D R P L L * R I R K * F R K L W K Y * R I V L C C K E * G N D S G S F G S T E G S S F V ----:----|----:----|----:----|----:----|----:----|----:----| T T F F L S I I G S A K S T S F S R G K R Q L S Y P F S E P L K P L V S P D D K N Y L I L F H N R F S Q F Y Q L I T R Q FatI BspHI |CviAII |Hpy178III* || MboI RsaI || BglII | Eco57I || XhoII | Eco57MI || | DpnI | | BsiYI* || | |BstKTI | | | HgiCI* || | || MseI | | | | NlaIV || | || |HpaI | | | | |SduI || NlaIII | || |HindII | | | | |BseSI TspEI || |MslI | || |Hpy166II \ \ \ \ \\ \ \\ \\ \ \\ \\ TACGCCGAAAAATGGGCACCATTTACTAAAGAATTAGCAGTCATGATTGTGAGATCTGTT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| ATGCGGCTTTTTACCCGTGGTAAATGATTTCTTAATCGTCAGTACTAACACTCTAGACAA // / / / / / / /// // / / || | | | HgiCI* TspEI | ||MslI || | Hpy166II || | | NlaIV | |BspHI || | HindII || | BseSI | |FatI || | HpaI || | SduI | | || XhoII || BsiYI* | | || BglII |Eco57MI | | || MboI |Eco57I | | |DpnI |Csp6I | | BstKTI RsaI | Hpy178III* | CviAII NlaIII Y A E K W A P F T K E L A V M I V R S V T P K N G H H L L K N * Q S * L * D L L R R K M G T I Y * R I S S H D C E I C * ----:----|----:----|----:----|----:----|----:----|----:----| Y A S F H A G N V L S N A T M I T L D T T R R F I P V M * * L I L L * S Q S I Q V G F F P C W K S F F * C D H N H S R N MfeI SspI TspEI | MaeIII Tsp4CI* | BsmAI | Tsp45I \ \ \ \ \ AACGGTTTAGTGTTTTCTTACCCAATTGTAGAGACTATCCACAAGGACAATATTTGTGAC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCCAAATCACAAAAGAATGGGTTAACATCTCTGATAGGTGTTCCTGTTATAAACACTG / / / / / / | Tsp4CI* | BsmAI SspI Tsp45I MseI TspEI MaeIII MfeI N G L V F S Y P I V E T I H K D N I C D T V * C F L T Q L * R L S T R T I F V T R F S V F L P N C R D Y P Q G Q Y L * L ----:----|----:----|----:----|----:----|----:----|----:----| L P K T N E * G I T S V I W L S L I Q S * R N L T K K G L Q L S * G C P C Y K H V T * H K R V W N Y L S D V L V I N T V Hin6I |GlaI ||HhaI ||| Cac8I ||| | MaeI ||| | | TspGWI ||| | | |MlyI ||| | | |PleI ||| | | || BetI* ||| | | || BspMII* ||| | | || |HpaII SmlI ||| | | || |Hpy178III* AflII ||| | | || || HinfI |MseI \\\ \ \ \\ \\ \ \\ TTATGTTATGCGCCTGCTAGAGTTCCGGACTCCGTTCAACTTAAGGCGAAGTTGTTGGCA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| AATACAATACGCGGACGATCTCAAGGCCTGAGGCAAGTTGAATTCCGCTTCAACAACCGT /// / / // // / // ||| | | || || HinfI |AflII ||| | | || |BspMII* |SmlI ||| | | || |BetI* MseI ||| | | || Hpy178III* ||| | | || HpaII ||| | | |PleI ||| | | MlyI ||| | TspGWI ||| | MaeI ||| Cac8I ||Hin6I |GlaI HhaI L C Y A P A R V P D S V Q L K A K L L A Y V M R L L E F R T P F N L R R S C W Q M L C A C * S S G L R S T * G E V V G R ----:----|----:----|----:----|----:----|----:----|----:----| K H * A G A L T G S E T * S L A F N N A S I N H A Q * L E P S R E V * P S T T P * T I R R S S N R V G N L K L R L Q Q C BssKI | HpaII MwoI | ScrFI BstAPI | CauII* | CviRI* | | BsiYI* \ \ \ \ \ GAAAATGCAATCAAATCTTTTCCCGGTTGTGGTATATTTGGTGTGGAAATGTTCTATTTA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTACGTTAGTTTAGAAAAGGGCCAACACCATATAAACCACACCTTTACAAGATAAAT / / /// | CviRI* ||BssKI BstAPI |BsiYI* MwoI |HpaII CauII* ScrFI E N A I K S F P G C G I F G V E M F Y L K M Q S N L F P V V V Y L V W K C S I * K C N Q I F S R L W Y I W C G N V L F R ----:----|----:----|----:----|----:----|----:----|----:----| S F A I L D K G P Q P I N P T S I N * K L F H L * I K E R N H Y I Q H P F T R N F I C D F R K G T T T Y K T H F H E I * StyI SecI* | StuI MnlI | CviJI Hpy178III* TspEI MseI TspEI | HaeIII | SfaNI \ \ \ \ \ \ \ GAAACAGGGGAATTGCTTATTAACGAAATTGCCCCAAGGCCTCACAACTCTGGACATTAT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTGTCCCCTTAACGAATAATTGCTTTAACGGGGTTCCGGAGTGTTGAGACCTGTAATA / / / // / / TspEI MseI TspEI |HaeIII | Hpy178III* |CviJI MnlI |StuI SecI* StyI E T G E L L I N E I A P R P H N S G H Y K Q G N C L L T K L P Q G L T T L D I I N R G I A Y * R N C P K A S Q L W T L Y ----:----|----:----|----:----|----:----|----:----|----:----| S V P S N S I L S I A G L G * L E P C * L F L P I A * * R F Q G L A E C S Q V N F C P F Q K N V F N G W P R V V R S M I MboI Cac8I AluI | DpnI | MaeIII CviJI | |BstKTI HgaI | Tsp45I TspEI | SetI | || SspI \ \ \ \ \ \ \ \\ \ ACCATTGATGCTTGCGTCACTTCTCAATTTGAAGCTCATTTGAGATCAATATTGGATTTG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTAACTACGAACGCAGTGAAGAGTTAAACTTCGAGTAAACTCTAGTTATAACCTAAAC / / / / / / / // / / SfaNI | Cac8I Tsp45I | | CviJI || | SspI HgaI MaeIII | | AluI || MboI | SetI |DpnI TspEI BstKTI T I D A C V T S Q F E A H L R S I L D L P L M L A S L L N L K L I * D Q Y W I C H * C L R H F S I * S S F E I N I G F A ----:----|----:----|----:----|----:----|----:----|----:----| V M S A Q T V E * N S A * K L D I N S K Y W Q H K R * K E I Q L E N S I L I P N G N I S A D S R L K F S M Q S * Y Q I Q ApoI TspEI \ CCAATGCCAAAGAATTTCACATCTTTCTCCACCATTACAACGAACGCCATTATGCTAAAT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTACGGTTTCTTAAAGTGTAGAAAGAGGTGGTAATGTTGCTTGCGGTAATACGATTTA / TspEI ApoI P M P K N F T S F S T I T T N A I M L N Q C Q R I S H L S P P L Q R T P L C * M N A K E F H I F L H H Y N E R H Y A K C ----:----|----:----|----:----|----:----|----:----|----:----| G I G F F K V D K E V M V V F A M I S F A L A L S N * M K R W W * L S R W * A L W H W L I E C R E G G N C R V G N H * I AluI GsuI CviJI Eco57MI |MaeI | MlyI BsmAI ||SetI | PleI HinfI \ \\\ \ \ \ GTTCTTGGAGACAAACATACAAAAGATAAAGAGCTAGAAACTTGCGAAAGAGCATTGGCG 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CAAGAACCTCTGTTTGTATGTTTTCTATTTCTCGATCTTTGAACGCTTTCTCGTAACCGC / / / / / // BsmAI | | MaeI Eco57MI |PleI | CviJI GsuI MlyI | AluI SetI V L G D K H T K D K E L E T C E R A L A F L E T N I Q K I K S * K L A K E H W R S W R Q T Y K R * R A R N L R K S I G D ----:----|----:----|----:----|----:----|----:----|----:----| T R P S L C V F S L S S S V Q S L A N A H E Q L C V Y L L Y L A L F K R F L M P N K S V F M C F I F L * F S A F S C Q R TatI BssKI |Csp6I HinfI EcoRII |Hpy166II | XbaI | ScrFI ||RsaI | |MaeI | BseBI |||TspRI | |Hpy178III* | | SetI ||||MnlI | || PleI MaeIII | | NlaIV ||||| BspCNI | || |MlyI Tsp45I | | | DdeI ||||| |BseMII | || || SetI | SetI \ \ \ \ \\\\\ \\ \ \\ \\ \ \ \ ACTCCAGGTTCCTCAGTGTACTTATATGGAAAAGAGTCTAGACCTAACAGAAAAGTAGGT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TGAGGTCCAAGGAGTCACATGAATATACCTTTTCTCAGATCTGGATTGTCTTTTCATCCA / // // / / //// // / // / / | || || | | |||| |BseMII | || PleI SetI | || || | | |||| BspCNI | || MlyI | || || | | |||TatI | |XbaI | || || | | ||Csp6I | |SetI | || || | | ||MnlI | Hpy178III* | || || | | |RsaI | MaeI | || || | | Hpy166II HinfI | || || | DdeI | || || TspRI | || |NlaIV | || EcoRII | || BssKI | |BseBI | |ScrFI | SetI HinfI T P G S S V Y L Y G K E S R P N R K V G L Q V P Q C T Y M E K S L D L T E K * V S R F L S V L I W K R V * T * Q K S R S ----:----|----:----|----:----|----:----|----:----|----:----| V G P E E T Y K Y P F S D L G L L F T P S E L N R L T S I H F L T * V * C F L L S W T G * H V * I S F L R S R V S F Y T GsuI Hpy166II Eco57MI MnlI | EciI | SspI BsrI |AciI | | CviJI AloI \ \ \ \\ \ \ \ \ CACATAAATATTATTGCCTCCAGTATGGCGGAATGTGAACAAAGGCTGAACTACATTACA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| GTGTATTTATAATAACGGAGGTCATACCGCCTTACACTTGTTTCCGACTTGATGTAATGT / / / / / / / / / / / | | SspI BsrI | AciI | | CviJI AloI SetI | Tsp45I MnlI | EciI | MaeIII Hpy166II Eco57MI GsuI H I N I I A S S M A E C E Q R L N Y I T T * I L L P P V W R N V N K G * T T L Q H K Y Y C L Q Y G G M * T K A E L H Y R ----:----|----:----|----:----|----:----|----:----|----:----| * M F I I A E L I A S H S C L S F * M V D C L Y * Q R W Y P P I H V F A S S C * V Y I N N G G T H R F T F L P Q V V N C AloI | FalI SetI MmeI | FalI MmeI \ \ \ \ \ GGTAGAACTGATATTCCAATCAAAATCTCTGTCGCTCAAAAGTTGGACTTGGAAGCAATG 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CCATCTTGACTATAAGGTTAGTTTTAGAGACAGCGAGTTTTCAACCTGAACCTTCGTTAC / / / / / / | | FalI MmeI | BsrDI | | FalI FalI | AloI FalI MmeI G R T D I P I K I S V A Q K L D L E A M V E L I F Q S K S L S L K S W T W K Q W * N * Y S N Q N L C R S K V G L G S N G ----:----|----:----|----:----|----:----|----:----|----:----| P L V S I G I L I E T A * F N S K S A I L Y F Q Y E L * F R Q R E F T P S P L L T S S I N W D F D R D S L L Q V Q F C H FatI |CviAII || NlaIII || |MlyI || |PleI || |MboI || || DpnI || || |BstKTI || || || Hpy188I || || || |HinfI || || || || BinI* PflMI || || || || |AlwNI BsrDI BsiYI* || || || || || Hpy188I AciI |FalI | TfiI || || || || || | Cfr10I BisI |FalI | HinfI || || || || || | |HpaII |BlsI \\ \ \ \\ \\ \\ \\ \\ \ \\ \\ GTCAAACCATTGGTTGGAATCATCATGGGATCAGACTCTGACTTGCCGGTAATGTCTGCC 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTTTGGTAACCAACCTTAGTAGTACCCTAGTCTGAGACTGAACGGCCATTACAGACGG / / / ///// / / // // /// BsiYI* | | ||||| | | |Hpy188I |Cfr10I ||BisI PflMI | | ||||| | | BinI* HpaII |BlsI | | ||||| | | HinfI TauI | | ||||| | AlwNI | | ||||| Hpy188I | | ||||| MboI | | ||||DpnI | | |||BstKTI | | |||PleI | | ||MlyI | | |FatI | | CviAII | NlaIII HinfI TfiI V K P L V G I I M G S D S D L P V M S A S N H W L E S S W D Q T L T C R * C L P Q T I G W N H H G I R L * L A G N V C R ----:----|----:----|----:----|----:----|----:----|----:----| T L G N T P I M M P D S E S K G T I D A P * V M P Q F * * P I L S Q S A P L T Q D F W Q N S D D H S * V R V Q R Y H R G FatI TauI |CviAII || MwoI || |NspI || |NlaIII MseI MaeIII || || AciI |AhaIII* Tsp45I PshAI BsmAI \\ \\ \ \\ \ \ \ GCATGTGCGGTTTTAAAAGATTTTGGCGTTCCATTTGAAGTGACAATAGTCTCTGCTCAT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CGTACACGCCAAAATTTTCTAAAACCGCAAGGTAAACTTCACTGTTATCAGAGACGAGTA / // / // / / / | || AciI |MseI | PshAI BsmAI | |FatI AhaIII* Tsp45I | CviAII MaeIII NlaIII MwoI AciI NspI A C A V L K D F G V P F E V T I V S A H H V R F * K I L A F H L K * Q * S L L I M C G F K R F W R S I * S D N S L C S * ----:----|----:----|----:----|----:----|----:----|----:----| A H A T K F S K P T G N S T V I T E A * R M H P K L L N Q R E M Q L S L L R Q E C T R N * F I K A N W K F H C Y D R S M MwoI BseGI |AciI | NdeI || Cac8I TspEI | | FokI || | Cac8I | MseI TspEI \ \ \ \\ \ \ \ \ \ AGAACTCCACATAGGATGTCAGCATATGCTATTTCCGCAAGCAAGCGTGGAATTAAAACA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTGAGGTGTATCCTACAGTCGTATACGATAAAGGCGTTCGTTCGCACCTTAATTTTGT / / / / / / // BseGI NdeI FokI | | Cac8I |MseI MwoI | Cac8I TspEI AciI R T P H R M S A Y A I S A S K R G I K T E L H I G C Q H M L F P Q A S V E L K Q N S T * D V S I C Y F R K Q A W N * N N ----:----|----:----|----:----|----:----|----:----|----:----| L V G C L I D A Y A I E A L L R P I L V Y F E V Y S T L M H * K R L C A H F * F S S W M P H * C I S N G C A L T S N F C BbvI | AluI GsuI | CviJI Eco57MI | | SetI | BbvI | | | MwoI | BssKI TseI | | | | TseI | EcoRII CviJI | | | | CviJI | | ScrFI |BisI | | | | |BisI | | BseBI ||BlsI | | | | ||BlsI | | | SetI |||CviRI* BsrDI \ \ \ \ \\\ \ \ \ \ \\\\ \ ATTATCGCTGGAGCTGGTGGGGCTGCTCACTTGCCAGGTATGGTGGCTGCAATGACACCA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TAATAGCGACCTCGACCACCCCGACGAGTGAACGGTCCATACCACCGACGTTACTGTGGT / / / / //// / //// //// / TspEI | | MwoI |||| Eco57MI |||EcoRII |||| BsrDI | CviJI |||| GsuI |||BssKI |||CviRI* | AluI |||TseI ||BbvI |||TseI | BbvI ||BisI |BseBI ||BisI SetI |BlsI |ScrFI |BlsI CviJI SetI CviJI I I A G A G G A A H L P G M V A A M T P L S L E L V G L L T C Q V W W L Q * H H Y R W S W W G C S L A R Y G G C N D T T ----:----|----:----|----:----|----:----|----:----|----:----| I I A P A P P A A * K G P I T A A I V G L * R Q L Q H P Q E S A L Y P P Q L S V N D S S S T P S S V Q W T H H S C H C W SduI BseSI | BsiYI* | | SetI | | | BccI | | | | XbaI BsiYI* | | | | |MaeI TfiI | MslI | | | | |Hpy178III* HinfI \ \ \ \ \ \ \\ \ CTTCCTGTCATCGGTGTGCCCGTAAAAGGTTCTTGTCTAGATGGAGTAGATTCTTTACAT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| GAAGGACAGTAGCCACACGGGCATTTTCCAAGAACAGATCTACCTCATCTAAGAAATGTA / / / / / / // / | | BseSI | SetI | |XbaI HinfI | | SduI BsiYI* | Hpy178III* TfiI | MslI | MaeI BsiYI* BccI L P V I G V P V K G S C L D G V D S L H F L S S V C P * K V L V * M E * I L Y I S C H R C A R K R F L S R W S R F F T F ----:----|----:----|----:----|----:----|----:----|----:----| S G T M P T G T F P E Q R S P T S E K C V E Q * R H A R L L N K D L H L L N K V K R D D T H G Y F T R T * I S Y I R * M AluI CviJI | SetI | | Tsp4CI* | | |MwoI | | || Hpy99I CviRI* | | || | MseI MfeI | MnlI SetI | | || | VspI Csp6I TspEI | | MaeI | BsrI | | || | | BbvI |RsaI \ \ \ \ \ \ \ \ \\ \ \ \ \\ TCAATTGTGCAAATGCCTAGAGGTGTTCCAGTAGCTACCGTCGCTATTAATAATAGTACG 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTAACACGTTTACGGATCTCCACAAGGTCATCGATGGCAGCGATAATTATTATCATGC / / / // / / / // / / // | | MnlI |SetI BsrI | | |Tsp4CI* VspI | |Csp6I | CviRI* MaeI | | |Hpy99I MseI | RsaI TspEI | | MwoI BbvI MfeI | CviJI | AluI SetI S I V Q M P R G V P V A T V A I N N S T Q L C K C L E V F Q * L P S L L I I V R N C A N A * R C S S S Y R R Y * * * Y E ----:----|----:----|----:----|----:----|----:----|----:----| E I T C I G L P T G T A V T A I L L L V N L Q A F A * L H E L L * R R * * Y Y Y * N H L H R S T N W Y S G D S N I I T R TseI |BisI ||BlsI Hin6I |||Hin6I |GlaI ||||GlaI ||HhaI |||||HhaI |||HaeII |||||| MwoI |||| TfiI |||||| | CviJI Hpy188I |||| HinfI \\\\\\ \ \ \ \\\\ \ AACGCTGCGCTGTTGGCTGTCAGACTGCTTGGCGCTTATGATTCAAGTTATACAACGAAA 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCGACGCGACAACCGACAGTCTGACGAACCGCGAATACTAAGTTCAATATGTTGCTTT ////// / / //// / |||||MwoI | Hpy188I |||Hin6I HinfI ||||Hin6I CviJI ||GlaI TfiI |||GlaI |HhaI ||TseI HaeII ||HhaI |BisI BlsI N A A L L A V R L L G A Y D S S Y T T K T L R C W L S D C L A L M I Q V I Q R K R C A V G C Q T A W R L * F K L Y N E N ----:----|----:----|----:----|----:----|----:----|----:----| F A A S N A T L S S P A * S E L * V V F S R Q A T P Q * V A Q R K H N L N Y L S V S R Q Q S D S Q K A S I I * T I C R F MseI | FalI MboII FalI Tsp4CI* | FalI XmnI | MboII FalI \ \ \ \ \ \ \ ATGGAACAGTTTTTATTAAAGCAAGAAGAAGAAGTTCTTGTCAAAGCACAAAAGTTAGAA 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTTGTCAAAAATAATTTCGTTCTTCTTCTTCAAGAACAGTTTCGTGTTTTCAATCTT / / / / / / / Tsp4CI* | MseI | | MboII FalI FalI | MboII FalI FalI XmnI M E Q F L L K Q E E E V L V K A Q K L E W N S F Y * S K K K K F L S K H K S * K G T V F I K A R R R S S C Q S T K V R N ----:----|----:----|----:----|----:----|----:----|----:----| I S C N K N F C S S S T R T L A C F N S F P V T K I L A L L L L E Q * L V F T L H F L K * * L L F F F N K D F C L L * F HindIII | AluI | CviJI | | SetI | | | XbaI Tsp4CI* | | | |MaeI | MaeIII | | | |Hpy178III* \ \ \ \ \ \\ ACTGTCGGTTACGAAGCTTATCTAGAAAACAAGTAA 1690 1700 1710 ----:----|----:----|----:----|----:- TGACAGCCAATGCTTCGAATAGATCTTTTGTTCATT / / / / / // Tsp4CI* | | | | |XbaI | | | | Hpy178III* | | | | MaeI | | | HindIII | | CviJI | | AluI | SetI MaeIII T V G Y E A Y L E N K * L S V T K L I * K T S X C R L R S L S R K Q V X ----:----|----:----|----:----|----:- V T P * S A * R S F L Y F Q R N R L K D L F C T S D T V F S I * F V L L # Enzymes that cut Frequency Isoschizomers AatII 1 AciI 4 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflII 1 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AhaIII* 1 DraI AloI 1 AluI 7 AluBI AlwNI 1 CaiI ApoI 3 AcsI,XapI BbvI 4 BseXI,BstV1I,Lsp1109I BccI 2 BetI* 2 BsaWI BglII 1 BinI* 2 AlwI,BspPI,AclWI BisI 5 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 5 BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 2 BstF5I,BtsCI BseMII 1 BseSI 2 BaeGI,BstSLI BsiYI* 5 Bsc4I,BseLI,BslI,AfiI BslFI 3 BsmFI,FaqI BsmAI 4 Alw26I,BstMAI BspCNI 1 BspHI 1 CciI,PagI,RcaI BspMII* 2 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrDI 2 BseMI,Bse3DI BsrI 3 BseNI,Bse1I,BsrSI BssKI 3 BstSCI,StyD4I BstAPI 1 BstKTI 4 BstXI 1 Cac8I 4 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I Cfr10I 1 BsrFI,BssAI,Bse118I Csp6I 4 CviQI,RsaNI CviAII 4 CviJI 15 CviKI-1 CviRI* 3 HpyCH4V DdeI 1 BstDEI,HpyF3I DpnI 4 MalI EciI 1 Eco57I 1 AcuI Eco57MI 5 EcoRII 2 AjnI,Psp6I,PspGI EcoRV 1 Eco32I Esp3I 1 BsmBI FalI 4 FatI 4 FokI 2 GlaI 3 GsuI 4 BpmI HaeII 1 BstH2I HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HhaI 3 BstHHI,CfoI,AspLEI Hin4II* 2 HpyAV Hin6I 3 HinP1I,HspAI HindII 1 HincII HindIII 2 HinfI 10 HpaI 1 KspAI HpaII 4 HapII,BsiSI,MspI Hpy166II 3 Hpy8I Hpy178III* 11 Hpy188III Hpy188I 4 Hpy99I 1 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 9 FspBI,BfaI,XspI MaeII 3 HpyCH4IV MaeIII 7 MboI 4 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 5 MfeI 3 MunI MlyI 4 SchI MmeI 3 MnlI 9 MseI 11 Tru1I,Tru9I MslI 4 RseI,SmiMI MwoI 6 HpyF10VI,BstMWI NdeI 1 FauNDI NlaIII 4 Hin1II,Hsp92II,FaeI NlaIV 3 BspLI,BmiI,PspN4I NspI 2 BstNSI,XceI PflMI 1 BasI,AccB7I,Van91I PleI 4 PpsI PshAI 1 BstPAI,BoxI RsaI 4 AfaI ScaI 1 BmcAI,AssI,ZrmI ScrFI 3 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 1 BseDI,BssECI,BsaJI SetI 18 SfaNI 2 LweI SmlI 1 SmoI SspI 3 StuI 1 Eco147I,PceI,SseBI,AatI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 3 TaqI 2 TatI 2 TauI 1 TfiI 6 PfeI TseI 4 ApeKI Tsp45I 4 NmuCI Tsp4CI* 6 HpyCH4III,TaaI,Bst4CI TspEI 13 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 2 TscAI VspI 1 PshBI,AseI XbaI 4 XhoII 1 BstYI,MflI,PsuI,BstX2I XmnI 2 MroXI,PdmI,Asp700I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AbsI Acc65I AccI AclI AflIII AgeI AjuI AlfI ApaI ApaLI AscI Asp718I AsuI* AsuII AvaI AvaII AvrII BaeI BalI BamHI BarI BbvCI BbvII* Bce83I* BceAI BcgI BciVI BclI BdaI BfiI BglI BmeT110I BmgT120I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BsePI BseRI BseYI BsgI BsiI* BsmI Bsp120I Bsp1407I BspLU11I* BspMI BspOI BsrBI BssNAI Bst1107I BstEII BstZ17I BtgZI BtrI BtsI Cfr9I CfrI ClaI CspCI DinI DraII DraIII DrdI DsaI* Eam1105I Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoP15I EcoRI EcoT22I EgeI EheI EspI* FauI FnuDII* FseI FspAI GsaI HgiAI* HgiJII* Hin4I HphI KasI KpnI MauBI McrI* MluI Mph1103I MroNI MstI* NaeI NarI NcoI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* OliI PacI PasI PfoI PmaCI PmeI PpiI PpuMI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SwaI TaqII TsoI TspDTI TspMI TstI Tth111I XcmI XhoI XmaCI XmaI XmaIII* Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769