Restriction Map of PSH1/YOL054W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

PSH1/YOL054W on chromosome XV from coordinates 228614 to 229834.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.32723

BstXI | HgiCI* HphI | | NlaIV TspEI Tsp4CI* | | | StyI Hpy99I | Hpy166II BccI | | | SecI* AcyI \ \ \ \ \ \ \ \ \ ATGGGCGACGAATTACACAACCGTTTACTTCACCAAAACGATGGCACCAAGGACGCCATA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCCGCTGCTTAATGTGTTGGCAAATGAAGTGGTTTTGCTACCGTGGTTCCTGCGGTAT / / / / // / / / / Hpy99I TspEI | Hpy166II |BstXI | | | AcyI Tsp4CI* BccI | | SecI* HphI | | StyI | HgiCI* NlaIV M G D E L H N R L L H Q N D G T K D A I W A T N Y T T V Y F T K T M A P R T P Y G R R I T Q P F T S P K R W H Q G R H T ----:----|----:----|----:----|----:----|----:----|----:----| X P S S N C L R K S * W F S P V L S A M X P R R I V C G N V E G F R H C W P R W H A V F * V V T * K V L V I A G L V G Y HgaI TfiI Csp6I | PsiI HinfI MwoI BccI |RsaI \ \ \ \ \ \\ CTTTATAAGATAATAGAATCGTTAGTTTGCTCCATCTGCCACGATTATATGTTTGTACCG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GAAATATTCTATTATCTTAGCAATCAAACGAGGTAGACGGTGCTAATATACAAACATGGC // / / / // |HgaI HinfI MwoI BccI |Csp6I PsiI TfiI RsaI L Y K I I E S L V C S I C H D Y M F V P F I R * * N R * F A P S A T I I C L Y R L * D N R I V S L L H L P R L Y V C T D ----:----|----:----|----:----|----:----|----:----|----:----| S * L I I S D N T Q E M Q W S * I N T G V K Y S L L I T L K S W R G R N Y T Q V K I L Y Y F R * N A G D A V I I H K Y R Hpy188I | BssKI | SexAI | EcoRII | | ScrFI SetI | | BseBI |DraIII TspEI | | |SetI Cac8I \\ \ \ \ \\ \ ATGATGACACCTTGTGGTCATAATTATTGCTATGGTTGTCTGAACACCTGGTTTGCCAGC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TACTACTGTGGAACACCAGTATTAATAACGATACCAACAGACTTGTGGACCAAACGGTCG / / / / / / / / | DraIII TspEI | | | | Cac8I SetI | | | EcoRII | | | SexAI | | | BssKI | | BseBI | | ScrFI | SetI Hpy188I M M T P C G H N Y C Y G C L N T W F A S * * H L V V I I I A M V V * T P G L P A D D T L W S * L L L W L S E H L V C Q Q ----:----|----:----|----:----|----:----|----:----|----:----| I I V G Q P * L * Q * P Q R F V Q N A L S S S V K H D Y N N S H N D S C R T Q W H H C R T T M I I A I T T Q V G P K G A CviRI* | MboI | BtsI | BglII | XhoII | TspRI | | DpnI | | |BstKTI TspEI CviJI AciI | | || Hpy188I BsgI AciI \ \ \ \ \ \\ \ \ \ AATACTCAAAAAGAATTGGCTTGTCCGCAGTGCAGATCTGATATTACCACCATTCCCGCA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTATGAGTTTTTCTTAACCGAACAGGCGTCACGTCTAGACTATAATGGTGGTAAGGGCGT / / / / / // / / / | CviJI | AciI | || Hpy188I BsgI AciI TspEI TspRI | || XhoII | || BglII | || MboI | |DpnI | BstKTI CviRI* BtsI N T Q K E L A C P Q C R S D I T T I P A I L K K N W L V R S A D L I L P P F P H Y S K R I G L S A V Q I * Y Y H H S R I ----:----|----:----|----:----|----:----|----:----|----:----| L V * F S N A Q G C H L D S I V V M G A C Y E F L I P K D A T C I Q Y * W W E R I S L F F Q S T R L A S R I N G G N G C AclI MaeII | SetI | TaiI AsuI* | | CviRI* AvaII | | | Tsp4CI* TspEI |NlaIV FauI | | | |TspDTI | MseI |BmgT120I \ \ \ \ \\ \ \ \\ TTGAATACAACGTTGCAACAGTATCTATCATTCATTTTAGAGAAATTAAGGGACCAGAAT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTATGTTGCAACGTTGTCATAGATAGTAAGTAAAATCTCTTTAATTCCCTGGTCTTA / / / / / // /// | | | | Tsp4CI* || ||AvaII | | | | TspDTI || ||AsuI* | | | CviRI* || |BmgT120I | | MaeII || NlaIV | | AclI |MseI | TaiI TspEI | SetI FauI L N T T L Q Q Y L S F I L E K L R D Q N * I Q R C N S I Y H S F * R N * G T R M E Y N V A T V S I I H F R E I K G P E * ----:----|----:----|----:----|----:----|----:----|----:----| N F V V N C C Y R D N M K S F N L S W F M S Y L T A V T D I M * K L S I L P G S Q I C R Q L L I * * E N * L F * P V L I MseI TfiI |AhaIII* MnlI HinfI || TspDTI | StyI BslFI || | MseI | SecI* \ \\ \ \ \ \ GATGAATCTTTTAAAAAACTTTTAACAACTAAAACCAAGGAGGAAAATGATTACAAGAAT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTTAGAAAATTTTTTGAAAATTGTTGATTTTGGTTCCTCCTTTTACTAATGTTCTTA // // / / / / || || TspDTI MseI MnlI SecI* || |MseI StyI || AhaIII* |BslFI HinfI TfiI D E S F K K L L T T K T K E E N D Y K N M N L L K N F * Q L K P R R K M I T R M * I F * K T F N N * N Q G G K * L Q E * ----:----|----:----|----:----|----:----|----:----|----:----| S S D K L F S K V V L V L S S F S * L F H H I K * F V K L L * F W P P F H N C S I F R K F F K * C S F G L L F I I V L I CfrI | MlyI | PleI | CviJI Hin6I | HaeIII AjuI |GlaI | |BtsI | MseI ||HhaI | |TspRI \ \ \\\ \ \\ GACAAGGAAAAGGACACATTGTTTGACAAAGTATTTAAGAATAGCGCATTGGCAGTGGCC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTTCCTTTTCCTGTGTAACAAACTGTTTCATAAATTCTTATCGCGTAACCGTCACCGG / / /// / //// AjuI MseI ||| TspRI |||CfrI ||Hin6I ||Hpy99I |GlaI ||PleI HhaI |HaeIII |CviJI |AjuI |MlyI BtsI D K E K D T L F D K V F K N S A L A V A T R K R T H C L T K Y L R I A H W Q W P Q G K G H I V * Q S I * E * R I G S G R ----:----|----:----|----:----|----:----|----:----|----:----| S L S F S V N N S L T N L F L A N A T A H C P F P C M T Q C L I * S Y R M P L P V L F L V C Q K V F Y K L I A C Q C H G AjuI |HinfI FokI |Hpy99I AflIII || BccI | MaeII || | Hpy188I | | SetI || | | BseGI | | TaiI TspEI TspEI MnlI \\ \ \ \ \ \ \ \ \ \ GACGACTCGGATGATGGTATCACACGTTGTAGTAATTGTCATTGGGAATTAGACCCAGAC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCTGAGCCTACTACCATAGTGTGCAACATCATTAACAGTAACCCTTAATCTGGGTCTG // / / / / / / || BseGI | AflIII TspEI TspEI MnlI |Hpy188I | MaeII |BccI | FokI HinfI TaiI SetI D D S D D G I T R C S N C H W E L D P D T T R M M V S H V V V I V I G N * T Q T R L G * W Y H T L * * L S L G I R P R R ----:----|----:----|----:----|----:----|----:----|----:----| S S E S S P I V R Q L L Q * Q S N S G S R R S P H H Y * V N Y Y N D N P I L G L V V R I I T D C T T T I T M P F * V W V TspGWI | MslI | CviRI* | | TspRI | | | BsrDI | | | | BsiYI* | | | | | AarI | | | | | BspMI SetI BslFI |BtsI | | | | | TspEI TspGWI \ \\ \ \ \ \ \ \ \ GAAGTAGAGGACGGAAATGTTTGTCCCCACTGCAATGCCAGAATACGGAATTACGCAGGT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCATCTCCTGCCTTTACAAACAGGGGTGACGTTACGGTCTTATGCCTTAATGCGTCCA / // / / / / / / / BslFI |TspRI | | BsiYI* | | | TspGWI |BtsI | BsrDI | | SetI TspGWI CviRI* | TspEI MslI BspMI AarI E V E D G N V C P H C N A R I R N Y A G K * R T E M F V P T A M P E Y G I T Q V S R G R K C L S P L Q C Q N T E L R R W ----:----|----:----|----:----|----:----|----:----|----:----| S T S S P F T Q G W Q L A L I R F * A P R L L P R F H K D G S C H W F V S N R L F Y L V S I N T G V A I G S Y P I V C T BseGI Hpy178III* Hin4II* | PfoI |NruI | MboII | BssKI |FnuDII* | Tsp4CI* | |HpaII || ApoI | |TspDTI | ||ScrFI || TspEI | || MboII | ||CauII* || Hpy99I MmeI | || | TspRI | ||| FokI \\ \ \ \ \\ \ \ \ \\\ \ GGTCGCGACGAATTTGATGAAGAAGAATACAGTGAAGGAGAGTTGGATGAAATCCGGGAA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CCAGCGCTGCTTAAACTACTTCTTCTTATGTCACTTCCTCTCAACCTACTTTAGGCCCTT // / / / / / / / / / || TspEI MmeI | | MboII BseGI | | TspDTI || ApoI | Tsp4CI* | BssKI |Hpy178III* | TspDTI | PfoI FnuDII* | MboII CauII* Hpy99I Hin4II* HpaII NruI TspRI ScrFI G R D E F D E E E Y S E G E L D E I R E V A T N L M K K N T V K E S W M K S G K S R R I * * R R I Q * R R V G * N P G K ----:----|----:----|----:----|----:----|----:----|----:----| P R S S N S S S S Y L S P S N S S I R S H D R R I Q H L L I C H L L T P H F G P T A V F K I F F F V T F S L Q I F D P F FatI TspDTI |CviAII HgaI ||Cac8I |TfiI ||| SphI |HinfI TspGWI ||| NspI || TaqI | AccI ||| NlaIII || ClaI | |Hpy166II \\\ \ \\ \ \ \\ AGCATGCGTAGGCGTAGAGAGAATCGATTTGCGTCTACCAATCCGTTTGCTAATAGAGAT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TCGTACGCATCCGCATCTCTCTTAGCTAAACGCAGATGGTTAGGCAAACGATTATCTCTA / /// /// / // | ||FatI ||| | |AccI | |CviAII ||| | Hpy166II | Cac8I ||| TspGWI NlaIII ||ClaI FokI ||TaqI NspI |HgaI SphI HinfI TfiI S M R R R R E N R F A S T N P F A N R D A C V G V E R I D L R L P I R L L I E M H A * A * R E S I C V Y Q S V C * * R * ----:----|----:----|----:----|----:----|----:----|----:----| L M R L R L S F R N A D V L G N A L L S F C A Y A Y L S D I Q T * W D T Q * Y L A H T P T S L I S K R R G I R K S I S I BbvII* | MboII | |Ksp632I* | || Eco57I | || Eco57MI | || |BtsI | || |TspRI | || || Hin4I | || || NlaIV | || || |CviJI | || || || FatI | || || || SduI | || || || HgiJII* | || || || |CviAII | || || || ||MboII | || || || ||| NlaIII | || || || ||| | BseRI Hpy188I | ||MnlI || || ||| | |BceAI \ \ \\\ \\ \\ \\\ \ \\ GATGTAAGTTCTGAAGACGATGATAGCAGTGAAGAGGAGCCCATGCGAGAACATATCCCA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CTACATTCAAGACTTCTGCTACTATCGTCACTTCTCCTCGGGTACGCTCTTGTATAGGGT / / / /// / /// // // / / Hpy188I | | ||| | ||| || || | BceAI | | ||| | ||| || || BseRI | | ||| | ||| || |FatI | | ||| | ||| || CviAII | | ||| | ||| |MboII | | ||| | ||| NlaIII | | ||| | ||CviJI | | ||| | |NlaIV | | ||| | HgiJII* | | ||| | SduI | | ||| Hin4I | | ||BtsI | | |Eco57MI | | |Eco57I | | Ksp632I* | MnlI BbvII* MboII TspRI D V S S E D D D S S E E E P M R E H I P M * V L K T M I A V K R S P C E N I S H C K F * R R * * Q * R G A H A R T Y P T ----:----|----:----|----:----|----:----|----:----|----:----| S T L E S S S S L L S S S G M R S C I G H H L N Q L R H Y C H L P A W A L V Y G I Y T R F V I I A T F L L G H S F M D W MaeI | XcmI | CviJI | HaeIII | | Hin4I | | |AsuI* | | ||BmgT120I | | |||BssKI | | |||CviJI | | |||EcoRII | | |||HaeIII | | |||| ScrFI | | |||| BseBI | | |||| | MaeIII | | |||| | Tsp45I FokI | | |||| | | SetI SfaNI MwoI BseGI | BseGI \ \ \\\\ \ \ \ \ \ \ \ \ CTAGGCCGTTGGGCCAGGTCACATAATCGTAGTATTGCTGTGGATGCTGTGGATGATGAA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| GATCCGGCAACCCGGTCCAGTGTATTAGCATCATAACGACACCTACGACACCTACTACTT /// //// / / / / / / / ||HaeIII |||| | Tsp45I | MwoI BseGI | FokI ||Hin4I |||| | MaeIII SfaNI BseGI ||CviJI |||| EcoRII |XcmI |||| BssKI MaeI |||BseBI |||ScrFI ||SetI |AsuI* BmgT120I HaeIII CviJI L G R W A R S H N R S I A V D A V D D E * A V G P G H I I V V L L W M L W M M K R P L G Q V T * S * Y C C G C C G * * R ----:----|----:----|----:----|----:----|----:----|----:----| S P R Q A L D C L R L I A T S A T S S S V L G N P W T V Y D Y Y Q Q P H Q P H H * A T P G P * M I T T N S H I S H I I F MboII | BseGI | |MboII | ||Ksp632I* | |||MnlI | |||| FokI FokI | |||| | BccI |BbvII* | |||| | | MboII |Ksp632I* | |||| | | | MboII ||MnlI | |||| | | | | TfiI |||Hpy99I | |||| | | | | HinfI |||| MboII | |||| | | | | MboII |||| |TspDTI | |||| | | | | | Hpy188I |||| ||MnlI | |||| | | | | | |BseRI MnlI \\\\ \\\ \ \\\\ \ \ \ \ \ \\ \ GACGACGAAGAAGAGGATGAGGAAGAAGAAGAGGAGATGGATTCCGATTTGAAAGATTTT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCTGCTTCTTCTCCTACTCCTTCTTCTTCTCCTCTACCTAAGGCTAAACTTTCTAAAA / / // / // / / / /// / / // / | | || MnlI || | | | ||| | | |Hpy188I MnlI | | |TspDTI || | | | ||| | | |BseRI | | |BbvII* || | | | ||| | | HinfI | | |MboII || | | | ||| | | TfiI | | Ksp632I* || | | | ||| | MboII | | FokI || | | | ||| MboII | MnlI || | | | ||MboII Hpy99I || | | | |FokI || | | | BccI || | | Ksp632I* || | MnlI || MboII |BseGI MboII D D E E E D E E E E E E M D S D L K D F T T K K R M R K K K R R W I P I * K I L R R R R G * G R R R G D G F R F E R F Y ----:----|----:----|----:----|----:----|----:----|----:----| S S S S S S S S S S S S I S E S K F S K L R R L L P H P L L L P S P N R N S L N V V F F L I L F F F L L H I G I Q F I K MboII |TspDTI || BsgI BccI || |ApoI MboII MboII || |TspEI BseGI FokI |TspDTI |MnlI || || Bce83I* \ \ \\ \\ \\ \\ \ ATAGAGGATGATGAAGATGACGAAGATGAAGATGGAAGTAGGAGGAATTTGGTATTGTCT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TATCTCCTACTACTTCTACTGCTTCTACTTCTACCTTCATCCTCCTTAAACCATAACAGA / // / // / / / / BseGI || BccI |MnlI | BsgI | TspEI |TspDTI MboII TspDTI | ApoI |MboII MboII Bce83I* FokI I E D D E D D E D E D G S R R N L V L S * R M M K M T K M K M E V G G I W Y C L R G * * R * R R * R W K * E E F G I V C ----:----|----:----|----:----|----:----|----:----|----:----| I S S S S S S S S S S P L L L F K T N D * L P H H L H R L H L H F Y S S N P I T Y L I I F I V F I F I S T P P I Q Y Q R CviRI* | SmlI | | Hpy178III* | | | FatI | | | AflIII | | | BspLU11I* | | | |CviAII MboII | | | || NspI | FatI | | | || NlaIII Ksp632I* | |BseRI | | | || |TspEI MnlI |MnlI | |CviAII \ \ \ \\ \\ \ \\ \ \\ GCACTCAAGAACAGACATGTAATTATTACTGATGATGAGGAAGAGGAGCAACGGCGACAT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CGTGAGTTCTTGTCTGTACATTAATAATGACTACTACTCCTTCTCCTCGTTGCCGCTGTA / / / // / / / / / // / CviRI* | | || | MnlI | Ksp632I* | || CviAII | | || TspEI MnlI | |NlaIII | | |BspLU11I* | |NspI | | |AflIII | BseRI | | |FatI MboII | | CviAII | NlaIII | NspI Hpy178III* SmlI A L K N R H V I I T D D E E E E Q R R H H S R T D M * L L L M M R K R S N G D M T Q E Q T C N Y Y * * * G R G A T A T C ----:----|----:----|----:----|----:----|----:----|----:----| A S L F L C T I I V S S S S S S C R R C Q V * S C V H L * * Q H H P L P A V A V C E L V S M Y N N S I I L F L L L P S M MboI | DpnI | |BstKTI | ||MboII NspI | ||Hpy178III* NlaIII | |||NruI |SfeI* | |||FnuDII* |Ksp632I* | |||| MboII ||MnlI | |||| MaeIII BccI ||| BceAI | |||| Tsp45I |MslI \\\ \ \ \\\\ \ \\ GCTACAGAAGAGGAAGATCGCGATAGTGACTTTTACGAGCATAATGATGATGGTTTTGTA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CGATGTCTTCTCCTTCTAGCGCTATCACTGAAAATGCTCGTATTACTACTACCAAAACAT // // / ////// / / / || || BceAI |||||| MboII Tsp45I MslI || |SfeI* |||||| MaeIII BccI || Ksp632I* |||||Hpy178III* |MnlI ||||FnuDII* FatI ||||NruI |||MboI ||MboII |DpnI BstKTI A T E E E D R D S D F Y E H N D D G F V L Q K R K I A I V T F T S I M M M V L * Y R R G R S R * * L L R A * * * W F C K ----:----|----:----|----:----|----:----|----:----|----:----| A V S S S S R S L S K * S C L S S P K T H * L L P L D R Y H S K R A Y H H H N Q S C F L F I A I T V K V L M I I I T K Y CviJI |MnlI || HphI || EcoNI || | BsiYI* || | | BsaBI || | | |MboI || | | |Hin4II* || | | || DpnI || | | || |MnlI || | | || |BstKTI || | | || || Hpy188I || | | || || | BinI* || | | || || | | MaeIII || | | || || | | | SetI TspGWI || | | || || | | | BciVI | Hpy188I BdaI || | | || || | | | | BdaI | |TfiI BdaI || | | || || | | | | BdaI TaqI | |HinfI \ \\ \ \ \\ \\ \ \ \ \ \ \ \ \\ AGTGGTGATAGCCTTGATGAGGATCAGAAGGAGGTTACACGGATACAATCGAGTTCTGAT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TCACCACTATCGGAACTACTCCTAGTCTTCCTCCAATGTGCCTATGTTAGCTCAAGACTA / / / / / // / // / / / // / BdaI | | | | || | || | | MaeIII || Hpy188I BdaI | | | | || | || | BdaI |TspGWI | | | | || | || | BdaI TaqI | | | | || | || BciVI | | | | || | |SetI | | | | || | BinI* | | | | || Hpy188I | | | | || MboI | | | | |DpnI | | | | |MnlI | | | | BstKTI | | | Hin4II* | | | BsaBI | | EcoNI | BsiYI* | HphI CviJI MnlI S G D S L D E D Q K E V T R I Q S S S D V V I A L M R I R R R L H G Y N R V L I W * * P * * G S E G G Y T D T I E F * F ----:----|----:----|----:----|----:----|----:----|----:----| L P S L R S S S * F S T V R I C D L E S L H H Y G Q H P D S P P * V S V I S N Q T T I A K I L I L L L N C P Y L R T R I Hpy188I | MboI | | DpnI | | |BstKTI | | || Hpy166II | | || | GsuI HpaII | | || | Eco57MI | CviJI | | || | |MboII | |NlaIV BtgZI \ \ \\ \ \\ \ \\ \ TCCGAAGATCGTTCACTTTCGTATTCCGGCTCCAGCGATGTCAAGGATAACAATGACGAT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| AGGCTTCTAGCAAGTGAAAGCATAAGGCCGAGGTCGCTACAGTTCCTATTGTTACTGCTA // // / / / /// / || || | | MboII ||NlaIV BtgZI || || | Hpy166II |CviJI || || | Eco57MI HpaII || || | GsuI || || MboI || |DpnI || BstKTI |Hpy188I HinfI TfiI S E D R S L S Y S G S S D V K D N N D D P K I V H F R I P A P A M S R I T M T I R R S F T F V F R L Q R C Q G * Q * R * ----:----|----:----|----:----|----:----|----:----|----:----| E S S R E S E Y E P E L S T L S L L S S N R L D N V K T N R S W R H * P Y C H R G F I T * K R I G A G A I D L I V I V I MboII TspGWI BsmAI TspEI TspGWI | XmnI | MaeI \ \ \ \ \ \ AACACGGAAGAATTAGATGACCCACAACCGAAAAGGCAGAAACGCTTCCGTGTAGTTCTA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTGCCTTCTTAATCTACTGGGTGTTGGCTTTTCCGTCTTTGCGAAGGCACATCAAGAT / // / / / | |MboII TspGWI XmnI BsmAI | TspGWI MaeI TspEI N T E E L D D P Q P K R Q K R F R V V L T R K N * M T H N R K G R N A S V * F * H G R I R * P T T E K A E T L P C S S R ----:----|----:----|----:----|----:----|----:----|----:----| L V S S N S S G C G F L C F R K R T T R Y C P L I L H G V V S F A S V S G H L E V R F F * I V W L R F P L F A E T Y N * MaeIII Tsp45I Tsp4CI* | TspRI \ \ GGAGACAGTGACGATGAATAA 1210 1220 ----:----|----:----|- CCTCTGTCACTGCTACTTATT / / / | | Tsp45I | | MaeIII | Tsp4CI* TspRI G D S D D E * E T V T M N X R Q * R * I X ----:----|----:----|- P S L S S S Y L L C H R H I S V T V I F L # Enzymes that cut Frequency Isoschizomers AarI 1 AccI 1 FblI,XmiI AciI 2 BspACI,SsiI AclI 1 Psp1406I AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 2 AhaIII* 1 DraI AjuI 1 ApoI 2 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 6 Bce83I* 1 BpuEI BceAI 2 BciVI 1 BfuI BdaI 2 BglII 1 BinI* 1 AlwI,BspPI,AclWI BmgT120I 2 BsaBI 1 Bse8I,BseJI BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 6 BstF5I,BtsCI BseRI 3 BsgI 2 BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI BspLU11I* 1 PscI,PciI BspMI 1 BfuAI,Acc36I,BveI BsrDI 1 BseMI,Bse3DI BssKI 3 BstSCI,StyD4I BstKTI 4 BstXI 1 BtgZI 1 BtsI 4 Cac8I 2 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I CfrI 1 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 1 CviQI,RsaNI CviAII 4 CviJI 7 CviKI-1 CviRI* 4 HpyCH4V DpnI 4 MalI DraIII 1 AdeI Eco57I 1 AcuI Eco57MI 2 EcoNI 1 BstENI,XagI EcoRII 2 AjnI,Psp6I,PspGI FatI 4 FauI 1 SmuI FnuDII* 2 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 6 GlaI 1 GsuI 1 BpmI HaeIII 3 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 1 BstHHI,CfoI,AspLEI Hin4I 1 Hin4II* 2 HpyAV Hin6I 1 HinP1I,HspAI HinfI 6 HpaII 2 HapII,BsiSI,MspI HphI 2 AsuHPI Hpy166II 3 Hpy8I Hpy178III* 3 Hpy188III Hpy188I 8 Hpy99I 4 Ksp632I* 5 Eam1104I,EarI,Bst6I MaeI 2 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 4 MboI 4 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 18 MlyI 1 SchI MmeI 1 MnlI 13 MseI 4 Tru1I,Tru9I MslI 2 RseI,SmiMI MwoI 2 HpyF10VI,BstMWI NlaIII 4 Hin1II,Hsp92II,FaeI NlaIV 4 BspLI,BmiI,PspN4I NruI 2 BtuMI,Bsp68I NspI 3 BstNSI,XceI PfoI 1 PleI 1 PpsI PsiI 1 AanI RsaI 1 AfaI ScrFI 3 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 2 BseDI,BssECI,BsaJI SetI 7 SexAI 1 MabI SfaNI 1 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 1 SmoI SphI 1 PaeI,BbuI StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 2 TaqI 2 TfiI 5 PfeI Tsp45I 3 NmuCI Tsp4CI* 4 HpyCH4III,TaaI,Bst4CI TspDTI 7 TspEI 11 TasI,Tsp509I,Sse9I TspGWI 6 TspRI 6 TscAI XcmI 1 XhoII 1 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AatII AbsI Acc65I AflII AgeI AlfI AloI AluI AlwNI ApaI ApaLI AscI Asp718I AsuII AvaI AvrII BaeI BalI BamHI BarI BbvCI BbvI BcgI BclI BetI* BfiI BglI BisI BlsI BmeT110I BmtI BplI Bpu10I BsaAI BsaXI BseMII BsePI BseSI BseYI BsiI* BsmI Bsp120I Bsp1407I BspCNI BspHI BspMII* BspOI BsrBI BsrI BssNAI Bst1107I BstAPI BstEII BstZ17I BtrI Cfr10I Cfr9I CspCI DdeI DinI DraII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoP15I EcoRI EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI Fnu4HI FseI FspAI GsaI HaeII HgiAI* HindII HindIII HpaI KasI KpnI MauBI McrI* MfeI MluI Mph1103I MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NsiI NspBII* OliI PacI PasI PflMI PmaCI PmeI PpiI PpuMI PshAI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TaqII TatI TauI TseI TsoI TspMI TstI Tth111I VspI XbaI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769