Restriction Map of ADH2/YMR303C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

ADH2/YMR303C on chromosome XIII from coordinates 874337 to 873291.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.26798

EMBOSS_001 MboII TfiI Hpy178III* |CviJI MmeI HinfI XcmI \ \\ \ \ \ ATGTCTATTCCAGAAACTCAAAAAGCCATTATCTTCTACGAATCCAACGGCAAGTTGGAG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGATAAGGTCTTTGAGTTTTTCGGTAATAGAAGATGCTTAGGTTGCCGTTCAACCTC / / / / / / Hpy178III* | CviJI MmeI HinfI XcmI MboII TfiI M S I P E T Q K A I I F Y E S N G K L E C L F Q K L K K P L S S T N P T A S W S V Y S R N S K S H Y L L R I Q R Q V G A ----:----|----:----|----:----|----:----|----:----|----:----| X D I G S V * F A M I K * S D L P L N S X T * E L F E F L W * R R R I W R C T P H R N W F S L F G N D E V F G V A L Q L MaeII | SetI BceAI | TaiI | BfiI | | TatI | |MmeI | | |Csp6I | ||EcoRV | | ||RsaI | ||| BsrI CviJI CviJI TspEI MseI | | ||ScaI \ \\\ \ \ \ \ \ \ \ \\\ CATAAGGATATCCCAGTTCCAAAGCCAAAGCCCAACGAATTGTTAATCAACGTCAAGTAC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GTATTCCTATAGGGTCAAGGTTTCGGTTTCGGGTTGCTTAACAATTAGTTGCAGTTCATG // / / / / / / / / /// || | BsrI CviJI CviJI | | | MaeII ||TatI || EcoRV | | TaiI |Csp6I |MmeI | | SetI ScaI |BfiI | MseI RsaI BceAI TspEI H K D I P V P K P K P N E L L I N V K Y I R I S Q F Q S Q S P T N C * S T S S T * G Y P S S K A K A Q R I V N Q R Q V L ----:----|----:----|----:----|----:----|----:----|----:----| C L S I G T G F G F G L S N N I L T L Y A Y P Y G L E L A L A W R I T L * R * T M L I D W N W L W L G V F Q * D V D L V CviRI* | Cac8I | | MwoI | | | FatI | | | |CviAII | | | || MaeIII | | | || Tsp45I | | | || NlaIII | | | || | CfrI | | | || | | BalI | | | || | | CviJI | | | || | | HaeIII | | | || | | |BsrI | | | || | | |BsrDI DdeI | | | || | | || HphI | MaeIII \ \ \ \\ \ \ \\ \ \ \ TCTGGTGTCTGCCACACCGATTTGCACGCTTGGCATGGTGACTGGCCATTGCCAACTAAG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AGACCACAGACGGTGTGGCTAAACGTGCGAACCGTACCACTGACCGGTAACGGTTGATTC / // / // / // // / | |MwoI | |FatI | || |HphI DdeI | Cac8I | | | || CfrI CviRI* | | | |HaeIII | | | |CviJI | | | |BalI | | | BsrDI | | | BsrI | | Tsp45I | | MaeIII | CviAII NlaIII S G V C H T D L H A W H G D W P L P T K L V S A T P I C T L G M V T G H C Q L S W C L P H R F A R L A W * L A I A N * V ----:----|----:----|----:----|----:----|----:----|----:----| E P T Q W V S K C A Q C P S Q G N G V L S Q H R G C R N A R K A H H S A M A L * R T D A V G I Q V S P M T V P W Q W S L PflMI BsiYI* | MaeIII | Tsp45I | Hin4II* | | Hpy178III* | | | OliI | | | MslI AclI | | | | HgiCI* MaeII | | | | | SetI | MseI | | | | | NlaIV FatI | SetI | | | | | |Cfr10I |CviAII | TaiI | | | | | ||HpaII TaqII || NlaIII | |TstI \ \ \ \ \ \\\ \ \\ \ \ \\ TTACCATTAGTTGGTGGTCACGAAGGTGCCGGTGTCGTTGTCGGCATGGGTGAAAACGTT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AATGGTAATCAACCACCAGTGCTTCCACGGCCACAGCAACAGCCGTACCCACTTTTGCAA / / / / / / / // / / // / / / | BsiYI* | | | | | || TaqII | |FatI | | HphI | PflMI | | | | | |Cfr10I | CviAII | MaeII MaeIII | | | | | HpaII NlaIII | AclI | | | | HgiCI* TaiI | | | NlaIV SetI | | MslI TstI | | OliI | | SetI | Hpy178III* | Tsp45I | MaeIII Hin4II* L P L V G G H E G A G V V V G M G E N V Y H * L V V T K V P V S L S A W V K T L T I S W W S R R C R C R C R H G * K R * ----:----|----:----|----:----|----:----|----:----|----:----| N G N T P P * S P A P T T T P M P S F T T V M L Q H D R L H R H R Q R C P H F R * W * N T T V F T G T D N D A H T F V N MboI |BaeI ||DpnI |||BstKTI |||| MaeIII |||| Tsp45I |||| | MboII |||| | | Cfr10I |||| | | |HpaII HphI |||| | | || HphI BaeI CviJI | CviJI |||| | | || | TstI |Tsp4CI* HaeIII \ \ \\\\ \ \ \\ \ \ \\ \ AAGGGCTGGAAGATCGGTGACTACGCCGGTATCAAATGGTTGAACGGTTCTTGTATGGCC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCCGACCTTCTAGCCACTGATGCGGCCATAGTTTACCAACTTGCCAAGAACATACCGG / / / // / // /// / / / | | BaeI || MboI || ||Cfr10I BaeI Tsp4CI* HaeIII | CviJI |DpnI || |HpaII CviJI MseI BstKTI || HphI || TstI |Tsp45I |MaeIII MboII K G W K I G D Y A G I K W L N G S C M A R A G R S V T T P V S N G * T V L V W P G L E D R * L R R Y Q M V E R F L Y G L ----:----|----:----|----:----|----:----|----:----|----:----| L P Q F I P S * A P I L H N F P E Q I A * P S S S R H S R R Y * I T S R N K Y P L A P L D T V V G T D F P Q V T R T H G MaeIII Tsp4CI* | TfiI TsoI MmeI | TspEI | HinfI Tsp4CI* | MnlI | MaeIII \ \ \ \ \ \ \ \ \ TGTGAATACTGTGAATTGGGTAACGAATCCAACTGTCCTCACGCTGACTTGTCTGGTTAC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| ACACTTATGACACTTAACCCATTGCTTAGGTTGACAGGAGTGCGACTGAACAGACCAATG / / / / / / / / / Tsp4CI* TspEI | | Tsp4CI* | MnlI MmeI MaeIII | HinfI TsoI | TfiI MaeIII C E Y C E L G N E S N C P H A D L S G Y V N T V N W V T N P T V L T L T C L V T * I L * I G * R I Q L S S R * L V W L H ----:----|----:----|----:----|----:----|----:----|----:----| Q S Y Q S N P L S D L Q G * A S K D P * R H I S H I P Y R I W S D E R Q S T Q N T F V T F Q T V F G V T R V S V Q R T V MwoI HgaI |Bce83I* || CviJI || |AciI || |BisI Hpy99I || ||BlsI Tsp4CI* BdaI AciI || |||TauI BdaI | TaqII BdaI | NspBII* || |||BsrBI BdaI \ \ \ \ \ \\ \\\\ \ ACCCACGACGGTTCTTTCCAAGAATACGCTACCGCTGACGCTGTTCAAGCCGCTCACATT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TGGGTGCTGCCAAGAAAGGTTCTTATGCGATGGCGACTGCGACAAGTTCGGCGAGTGTAA / / / / / / / //// / | | TaqII BdaI NspBII* | | |||| BdaI | Tsp4CI* BdaI AciI | | |||| BdaI Hpy99I | | |||BsrBI | | |||AciI | | ||HgaI | | ||BisI | | |BlsI | | CviJI | | TauI | Bce83I* MwoI T H D G S F Q E Y A T A D A V Q A A H I P T T V L S K N T L P L T L F K P L T F P R R F F P R I R Y R * R C S S R S H S ----:----|----:----|----:----|----:----|----:----|----:----| V W S P E K W S Y A V A S A T * A A * M C G R R N K G L I R * R Q R Q E L R E C G V V T R E L F V S G S V S N L G S V N MwoI Csp6I | Hin6I Tsp4CI* |RsaI | FnuDII* Eco57I | AccI |SetI | |GlaI Eco57MI | |BssNAI SmlI || MnlI CviJI | ||HhaI |HphI | |Hpy166II \ \\ \ \ \ \\\ \\ \ \\ CCTCAAGGTACTGACTTGGCTGAAGTCGCGCCAATCTTGTGTGCTGGTATCACCGTATAC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GGAGTTCCATGACTGAACCGACTTCAGCGCGGTTAGAACACACGACCATAGTGGCATATG // // / / /// / / / // || |Csp6I | MwoI ||Hin6I | HphI | |AccI || |MnlI CviJI |GlaI Eco57MI | Hpy166II || RsaI FnuDII* Eco57I | BssNAI |SmlI HhaI Tsp4CI* SetI P Q G T D L A E V A P I L C A G I T V Y L K V L T W L K S R Q S C V L V S P Y T S R Y * L G * S R A N L V C W Y H R I Q ----:----|----:----|----:----|----:----|----:----|----:----| G * P V S K A S T A G I K H A P I V T Y E E L Y Q S P Q L R A L R T H Q Y * R I R L T S V Q S F D R W D Q T S T D G Y V BsiYI* |AciI |BsrI |TspRI ||CfrI ||BisI |||BbvI |||BlsI |||Bce83I* EcoP15I ||||TauI | Cac8I ||||CviJI TseI | | CviJI ||||HaeIII |BisI CviJI SmlI | | HaeIII ||||| BfiI ||BlsI \ \ \ \ \ \\\\\ \ \\\ AAGGCTTTGAAGTCTGCCAACTTGAGAGCAGGCCACTGGGCGGCCATTTCTGGTGCTGCT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCGAAACTTCAGACGGTTGAACTCTCGTCCGGTGACCCGCCGGTAAAGACCACGACGA / / /// / / /////// /// CviJI SmlI ||| | | ||||||BbvI ||TseI ||| | | |||||CfrI |BisI ||| | | ||||BfiI BlsI ||| | | |||HaeIII ||| | | |||CviJI ||| | | ||BisI ||| | | ||AciI ||| | | |BlsI ||| | | Bce83I* ||| | | TauI ||| | BsrI ||| BsiYI* ||HaeIII ||CviJI |TspRI EcoP15I Cac8I K A L K S A N L R A G H W A A I S G A A R L * S L P T * E Q A T G R P F L V L L G F E V C Q L E S R P L G G H F W C C W ----:----|----:----|----:----|----:----|----:----|----:----| L A K F D A L K L A P W Q A A M E P A A C P K S T Q W S S L L G S P P W K Q H Q L S Q L R G V Q S C A V P R G N R T S S HinfI | BtgZI | | DdeI | | | BccI DdeI | | | PleI Bpu10I | | | |MlyI MaeI SetI CviJI |BccI MaeIII | | | ||SetI \ \ \ \\ \ \ \ \ \\\ GGTGGTCTAGGTTCTTTGGCTGTTCAATATGCTAAGGCGATGGGTTACAGAGTCTTAGGT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CCACCAGATCCAAGAAACCGACAAGTTATACGATTCCGCTACCCAATGTCTCAGAATCCA // / // / / // / |MaeI CviJI |Bpu10I | | || PleI SetI |DdeI | | || MlyI BccI | | || BccI | | |DdeI | | BtgZI | | SetI | HinfI MaeIII G G L G S L A V Q Y A K A M G Y R V L G V V * V L W L F N M L R R W V T E S * V W S R F F G C S I C * G D G L Q S L R Y ----:----|----:----|----:----|----:----|----:----|----:----| P P R P E K A T * Y A L A I P * L T K P Q H D L N K P Q E I H * P S P N C L R L T T * T R Q S N L I S L R H T V S D * T AsuI* AvaII |BmgT120I ||PfoI ||BssKI ||EcoRII Hpy166II HphI ||| ScrFI | MboII MnlI |HphI ||| BseBI TspEI | | SetI TspDTI ||TaqI \\\ \ \ \ \ \ \ \\\ ATTGATGGTGGTCCAGGAAAGGAAGAATTGTTTACCTCGCTCGGTGGTGAAGTATTCATC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TAACTACCACCAGGTCCTTTCCTTCTTAACAAATGGAGCGAGCCACCACTTCATAAGTAG // / / / // // // || | EcoRII | |MboII |MnlI |HphI || | BssKI | |SetI TspDTI HphI || | PfoI | Hpy166II || BseBI TspEI || ScrFI |AvaII |AsuI* BmgT120I I D G G P G K E E L F T S L G G E V F I L M V V Q E R K N C L P R S V V K Y S S * W W S R K G R I V Y L A R W * S I H R ----:----|----:----|----:----|----:----|----:----|----:----| I S P P G P F S S N N V E S P P S T N M Y Q H H D L F P L I T * R A R H H L I * N I T T W S L F F Q K G R E T T F Y E D AciI | HgiCI* | | NlaIV | | | SduI Hin6I | | | SecI* |GlaI | | | DsaI* Hin4II* ||HhaI MseI CviJI | | | BseSI \ \\\ \ \ \ \ \ \ GACTTCACCAAAGAGAAGGACATTGTTAGCGCAGTCGTTAAGGCTACCAACGGCGGTGCC 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CTGAAGTGGTTTCTCTTCCTGTAACAATCGCGTCAGCAATTCCGATGGTTGCCGCCACGG / / /// / / /// / TaqI Hin4II* ||Hin6I | CviJI ||| HgiCI* |GlaI MseI ||NlaIV HhaI |BseSI |SduI AciI D F T K E K D I V S A V V K A T N G G A T S P K R R T L L A Q S L R L P T A V P L H Q R E G H C * R S R * G Y Q R R C P ----:----|----:----|----:----|----:----|----:----|----:----| S K V L S F S M T L A T T L A V L P P A R S * W L S P C Q * R L R * P * W R R H V E G F L L V N N A C D N L S G V A T G Hpy188I | CviJI | |AciI | |BisI | ||BlsI | |||TauI | |||| TaqI | |||| | MwoI | |||| | |HindIII Tsp4CI* | |||| | || AluI AlwNI | BceAI | |||| | || CviJI |SfeI* | | TspGWI | |||| | || | SetI ||Tsp4CI* \ \ \ \ \\\\ \ \\ \ \ \\\ CACGGTATCATCAATGTTTCCGTTTCCGAAGCCGCTATCGAAGCTTCTACCAGATACTGT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| GTGCCATAGTAGTTACAAAGGCAAAGGCTTCGGCGATAGCTTCGAAGATGGTCTATGACA // // / //// / // / / / / || |BceAI | |||| | || | HindIII | Tsp4CI* || TspGWI | |||| | || CviJI | BaeI |DsaI* | |||| | || AluI AlwNI |SecI* | |||| | |SetI Tsp4CI* | |||| | TaqI | |||| MwoI | |||AciI | ||BisI | |BlsI | CviJI | TauI Hpy188I H G I I N V S V S E A A I E A S T R Y C T V S S M F P F P K P L S K L L P D T V R Y H Q C F R F R S R Y R S F Y Q I L * ----:----|----:----|----:----|----:----|----:----|----:----| W P I M L T E T E S A A I S A E V L Y Q G R Y * * H K R K R L R * R L K * W I S V T D D I N G N G F G S D F S R G S V T BaeI Cac8I | CviJI SduI Tsp4CI* | Cfr10I HgiAI* |Csp6I | |HpaII | MboII ||RsaI | || BseRI | BbvII* BaeI ||| Tsp4CI* | || |CviRI* | | Hpy188I \ \\\ \ \ \\ \\ \ \ \ AGGGCGAACGGTACTGTTGTCTTGGTTGGTTTGCCAGCCGGTGCAAAGTGCTCCTCTGAT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TCCCGCTTGCCATGACAACAGAACCAACCAAACGGTCGGCCACGTTTCACGAGGAGACTA / / /// / / / // / / / / / SfeI* | ||Tsp4CI* BaeI | | || | | | | BbvII* | |Csp6I | | || | | | Hpy188I | RsaI | | || | | MboII Tsp4CI* | | || | HgiAI* | | || | SduI | | || CviRI* | | |Cfr10I | | HpaII | | BseRI | CviJI Cac8I R A N G T V V L V G L P A G A K C S S D G R T V L L S W L V C Q P V Q S A P L M G E R Y C C L G W F A S R C K V L L * C ----:----|----:----|----:----|----:----|----:----|----:----| L A F P V T T K T P K G A P A F H E E S Y P S R Y Q Q R P Q N A L R H L T S R Q P R V T S N D Q N T Q W G T C L A G R I MaeII MaeII |BsaAI AluI | SetI || SetI CviJI MnlI | TaiI CviJI || TaiI | SetI \ \ \ \ \\ \ \ \ GTCTTCAACCACGTTGTCAAGTCTATCTCCATTGTCGGCTCTTACGTGGGGAACAGAGCT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CAGAAGTTGGTGCAACAGTTCAGATAGAGGTAACAGCCGAGAATGCACCCCTTGTCTCGA / / / / / // / / MnlI | MaeII | | |MaeII | CviJI TaiI | | BsaAI | AluI SetI | TaiI SetI | SetI CviJI V F N H V V K S I S I V G S Y V G N R A S S T T L S S L S P L S A L T W G T E L L Q P R C Q V Y L H C R L L R G E Q S * ----:----|----:----|----:----|----:----|----:----|----:----| T K L W T T L D I E M T P E * T P F L A H R * G R Q * T * R W Q R S K R P S C L D E V V N D L R D G N D A R V H P V S S BsmAI CviJI Hin4I SetI | Hin4I | DdeI | MnlI |MaeI | | SetI \ \ \ \ \\ \ \ \ GATACCAGAGAAGCCTTAGATTTCTTTGCCAGAGGTCTAGTCAAGTCTCCAATAAAGGTA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CTATGGTCTCTTCGGAATCTAAAGAAACGGTCTCCAGATCAGTTCAGAGGTTATTTCCAT / / / / / / // | Hin4I MnlI SetI MaeI | |SetI | DdeI | BsmAI CviJI Hin4I D T R E A L D F F A R G L V K S P I K V I P E K P * I S L P E V * S S L Q * R * Y Q R S L R F L C Q R S S Q V S N K G S ----:----|----:----|----:----|----:----|----:----|----:----| S V L S A K S K K A L P R T L D G I F T Q Y W L L R L N R Q W L D L * T E L L P I G S F G * I E K G S T * D L R W Y L Y AsuI* |BmgT120I ||CviJI Hpy166II ||HaeIII | ApoI ||| TspEI CviJI BsrI | TspEI BccI Hin4II* ||| | BstXI \ \ \ \ \ \ \\\ \ \ GTTGGCTTATCCAGTTTACCAGAAATTTACGAAAAGATGGAGAAGGGCCAAATTGCTGGT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CAACCGAATAGGTCAAATGGTCTTTAAATGCTTTTCTACCTCTTCCCGGTTTAACGACCA / / / / / / // / / | BsrI Hpy166II | | Hin4II* || | TspEI CviJI | BccI || BstXI TspEI |AsuI* ApoI BmgT120I HaeIII CviJI V G L S S L P E I Y E K M E K G Q I A G L A Y P V Y Q K F T K R W R R A K L L V W L I Q F T R N L R K D G E G P N C W * ----:----|----:----|----:----|----:----|----:----|----:----| T P K D L K G S I * S F I S F P W I A P L Q S I W N V L F K R F S P S P G F Q Q N A * G T * W F N V F L H L L A L N S T MaeII | SetI | TaiI | | HindII | | Hpy166II \ \ \ AGATACGTTGTTGACACTTCTAAATAA 1030 1040 ----:----|----:----|----:-- TCTATGCAACAACTGTGAAGATTTATT / / / | | Hpy166II | | HindII | MaeII TaiI SetI R Y V V D T S K * D T L L T L L N X I R C * H F * I X ----:----|----:----|----:-- L Y T T S V E L Y Y I R Q Q C K * I S V N N V S R F L # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 5 BspACI,SsiI AclI 1 Psp1406I AluI 2 AluBI AlwNI 1 CaiI ApoI 1 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BaeI 2 BalI 1 MlsI,MluNI,MscI,Msp20I BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 3 Bce83I* 2 BpuEI BceAI 2 BdaI 2 BfiI 2 BmrI,BmuI BisI 4 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 4 BmgT120I 2 Bpu10I 1 BsaAI 1 BstBAI,Ppu21I BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseRI 1 BseSI 1 BaeGI,BstSLI BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BsmAI 1 Alw26I,BstMAI BsrBI 1 AccBSI,MbiI BsrDI 1 BseMI,Bse3DI BsrI 4 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstKTI 1 BstXI 1 BtgZI 1 Cac8I 3 BstC8I Cfr10I 3 BsrFI,BssAI,Bse118I CfrI 2 AcoI,EaeI Csp6I 3 CviQI,RsaNI CviAII 2 CviJI 21 CviKI-1 CviRI* 2 HpyCH4V DdeI 4 BstDEI,HpyF3I DpnI 1 MalI DsaI* 1 BtgI,BstDSI Eco57I 1 AcuI Eco57MI 1 EcoP15I 1 EcoRII 1 AjnI,Psp6I,PspGI EcoRV 1 Eco32I FatI 2 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII GlaI 2 HaeIII 5 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 2 BanI,BshNI,BspT107I,AccB1I HhaI 2 BstHHI,CfoI,AspLEI Hin4I 1 Hin4II* 3 HpyAV Hin6I 2 HinP1I,HspAI HindII 1 HincII HindIII 1 HinfI 3 HpaII 3 HapII,BsiSI,MspI HphI 6 AsuHPI Hpy166II 4 Hpy8I Hpy178III* 2 Hpy188III Hpy188I 2 Hpy99I 1 MaeI 2 FspBI,BfaI,XspI MaeII 5 HpyCH4IV MaeIII 7 MboI 1 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 4 MlyI 1 SchI MmeI 3 MnlI 5 MseI 3 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 4 HpyF10VI,BstMWI NlaIII 2 Hin1II,Hsp92II,FaeI NlaIV 2 BspLI,BmiI,PspN4I NspBII* 1 MspA1I OliI 1 AleI PflMI 1 BasI,AccB7I,Van91I PfoI 1 PleI 1 PpsI RsaI 3 AfaI ScaI 1 BmcAI,AssI,ZrmI ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 1 BseDI,BssECI,BsaJI SetI 14 SfeI* 1 BstSFI,SfcI,BfmI SmlI 2 SmoI TaiI 5 TaqI 2 TaqII 2 TatI 1 TauI 3 TfiI 2 PfeI TseI 1 ApeKI TsoI 1 Tsp45I 3 NmuCI Tsp4CI* 9 HpyCH4III,TaaI,Bst4CI TspDTI 1 TspEI 5 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 1 TscAI TstI 1 XcmI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI ApaI ApaLI AscI Asp718I AsuII AvaI AvrII BamHI BarI BbvCI BcgI BciVI BclI BetI* BglI BglII BinI* BmeT110I BmtI BplI BsaBI BsaXI BseGI BseMII BsePI BseYI BsgI BsiI* BslFI BsmFI BsmI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMI BspMII* BspOI BstAPI BstEII BstF5I BtrI BtsCI BtsI CauII* Cfr9I ClaI CspCI DinI DraII DraIII DrdI Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoRI EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FauI FokI FseI FspAI GsaI GsuI HaeII HgiJII* HpaI KasI KpnI Ksp632I* MauBI McrI* MfeI MluI Mph1103I MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspI PacI PasI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* SexAI SfaNI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyI SwaI TspMI Tth111I VspI XbaI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769