Restriction Map of AVO2/YMR068W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

AVO2/YMR068W on chromosome XIII from coordinates 406304 to 407584.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.5823

CviJI | SduI | HgiJII* | | FauI | | | MnlI | | | |Cac8I | | | || AciI | | | || |BspCNI | | | || ||BseMII | | | || ||| CviJI | | | || ||| |BarI | |DdeI | || ||| || Hin4II* TspEI \ \\ \ \\ \\\ \\ \ \ ATGTTGAAAGAGCCCTCAGTTCGCTTGCGGGAGGCTATTATTGAAGGCAATTTACTTATA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAACTTTCTCGGGAGTCAAGCGAACGCCCTCCGATAATAACTTCCGTTAAATGAATAT / / / // /// // / / / | CviJI | || ||| || | Hin4II* TspEI HgiJII* | || ||| || CviJI SduI | || ||| |BarI | || ||| AciI | || ||BseMII | || |BspCNI | || Cac8I | |MnlI | FauI DdeI M L K E P S V R L R E A I I E G N L L I C * K S P Q F A C G R L L L K A I Y L * V E R A L S S L A G G Y Y * R Q F T Y S ----:----|----:----|----:----|----:----|----:----|----:----| X N F S G E T R K R S A I I S P L K S I X T S L A R L E S A P P * * Q L C N V * H Q F L G * N A Q P L S N N F A I * K Y Hpy99I |TfiI |HinfI HinfI || BetI* | DdeI || BspMII* | | TsoI || |HpaII | | Hpy188I || |Hpy178III* MlyI | | | BccI BarI || || TspGWI PleI | | | | TspDTI \ \\ \\ \ \ \ \ \ \ \ GTGAAAAGATTATTGCGACGGAATCCGGATTTGCTAACCAACATAGACTCAGAGAACGGA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CACTTTTCTAATAACGCTGCCTTAGGCCTAAACGATTGGTTGTATCTGAGTCTCTTGCCT / / / // / // /// / // BarI Hpy99I | || TspGWI |PleI ||| | |BseMII | |BspMII* MlyI ||| | BspCNI | |BetI* ||| TspDTI | Hpy178III* ||| BccI | HpaII ||DdeI HinfI |Hpy188I TfiI HinfI TsoI V K R L L R R N P D L L T N I D S E N G * K D Y C D G I R I C * P T * T Q R T D E K I I A T E S G F A N Q H R L R E R M ----:----|----:----|----:----|----:----|----:----|----:----| T F L N N R R F G S K S V L M S E S F P L S F I I A V S D P N A L W C L S L S R H F S * Q S P I R I Q * G V Y V * L V S FatI NcoI StyI SecI* DsaI* BspCNI |CviAII |BseMII FokI || MnlI SetI MseI || BseGI TspGWI || |NlaIII | MboII |TspEI \\ \ \ \\ \\ \ \ \\ TGGAGTTCATTACATTACGCCTCATACCATGGAAGATACCTTATATGCGTGTATTTAATT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| ACCTCAAGTAATGTAATGCGGAGTATGGTACCTTCTATGGAATATACGCACATAAATTAA / / / / /// / / / / BseGI | FokI | ||DsaI* SetI MboII | TspEI TspGWI | ||SecI* MseI | ||StyI | ||NcoI | ||FatI | |CviAII | MnlI NlaIII W S S L H Y A S Y H G R Y L I C V Y L I G V H Y I T P H T M E D T L Y A C I * F E F I T L R L I P W K I P Y M R V F N S ----:----|----:----|----:----|----:----|----:----|----:----| H L E N C * A E Y W P L Y R I H T Y K I I S N M V N R R M G H F I G * I R T N L P T * * M V G * V M S S V K Y A H I * N AluI BseYI CviJI PvuII NspBII* | SetI | | GsaI | | | SduI | | | BseSI | | | | MwoI TspDTI | | | | | FatI | SetI SetI | | | | | |CviAII | |MseI OliI | | | | | || NlaIII | ||AhaIII* MslI CviRI* \ \ \ \ \ \\ \ \ \\\ \ \ CAGCTGGGGCACGACAAGCATGAACTAATAAAAACCTTTAAAGGAAACACCTGTGTGCAT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GTCGACCCCGTGCTGTTCGTACTTGATTATTTTTGGAAATTTCCTTTGTGGACACACGTA / / / / / // / // / / / | | | MwoI | |FatI | |MseI | MslI CviRI* | | BseSI | CviAII | AhaIII* | OliI | | BseYI NlaIII TspDTI SetI | | SduI SetI | NspBII* | PvuII | CviJI | AluI | GsaI SetI Q L G H D K H E L I K T F K G N T C V H S W G T T S M N * * K P L K E T P V C I A G A R Q A * T N K N L * R K H L C A F ----:----|----:----|----:----|----:----|----:----|----:----| * S P C S L C S S I F V K L P F V Q T C E A P A R C A H V L L F R * L F C R H A L Q P V V L M F * Y F G K F S V G T H M BsiI* |SduI |BseSI AciI MseI || TspDTI CviRI* BtgZI VspI || | SetI | TspEI | FnuDII* \ \\ \ \ \ \ \ \ TTAGCATTAATGAAAGGGCACGAGCAAACCTTACATTTACTTTTGCAACAATTTCCGCGA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AATCGTAATTACTTTCCCGTGCTCGTTTGGAATGTAAATGAAAACGTTGTTAAAGGCGCT / / / / / / / / VspI BseSI | SetI CviRI* | | BtgZI MseI SduI TspDTI | FnuDII* BsiI* | AciI TspEI L A L M K G H E Q T L H L L L Q Q F P R * H * * K G T S K P Y I Y F C N N F R D S I N E R A R A N L T F T F A T I S A I ----:----|----:----|----:----|----:----|----:----|----:----| K A N I F P C S C V K C K S K C C N G R N L M L S L A R A F R V N V K A V I E A * C * H F P V L L G * M * K Q L L K R S BccI | PsrI AciI | FatI FnuDII* CviJI | |CviAII | BccI | SduI | || NspI | | Hin4I | HgiJII* | || NlaIII | | | FokI | | BseGI | || | Hin4I \ \ \ \ \ \ \ \ \\ \ \ TTTATCAACCATCGCGGAGAGAATGGTAGAGCCCCCATCCATATAGCATGTATGAACGAT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| AAATAGTTGGTAGCGCCTCTCTTACCATCTCGGGGGTAGGTATATCGTACATACTTGCTA /// / / / / / / / // // ||| BccI | | | BseGI | | || |FatI ||AciI | | CviJI | | || CviAII |Hin4I | HgiJII* | | |Hin4I FnuDII* | SduI | | NlaIII FokI | | NspI | BccI PsrI F I N H R G E N G R A P I H I A C M N D L S T I A E R M V E P P S I * H V * T I Y Q P S R R E W * S P H P Y S M Y E R L ----:----|----:----|----:----|----:----|----:----|----:----| N I L W R P S F P L A G M W I A H I F S I * * G D R L S H Y L G W G Y L M Y S R K D V M A S L I T S G G D M Y C T H V I BseMII |BspCNI || TspDTI || | DdeI || | |Hpy188I || | ||HinfI PleI || | ||| PsrI |MlyI \\ \ \\\ \ \\ TACTACCAATGTCTGAGTCTGTTGATAGGAGTTGGTGCTGATTTATGGGTAATGGACACT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| ATGATGGTTACAGACTCAGACAACTATCCTCAACCACGACTAAATACCCATTACCTGTGA // / / / / / || TspDTI | | HinfI PleI |BspCNI | DdeI MlyI BseMII Hpy188I PsrI Y Y Q C L S L L I G V G A D L W V M D T T T N V * V C * * E L V L I Y G * W T L L P M S E S V D R S W C * F M G N G H * ----:----|----:----|----:----|----:----|----:----|----:----| * * W H R L R N I P T P A S K H T I S V N S G I D S D T S L L Q H Q N I P L P C V V L T Q T Q Q Y S N T S I * P Y H V S AciI BisI |BlsI ||TseI ||TauI ||NspBII* |||BisI ||||BlsI |||||FatI |||||CviRI* ||||||CviAII ||||||| NspI ||||||| NlaIII ||||||| | BssKI ||||||| | EcoRII SfaNI ||||||| | | ScrFI | GsuI BbvI ||||||| | | BseBI | Eco57MI \ \\\\\\\ \ \ \ \ \ AATGGCGACACGCCGCTGCATGTATGCCTGGAGTATGGCAGTATAAGTTGTATGAAGATG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TTACCGCTGTGCGGCGACGTACATACGGACCTCATACCGTCATATTCAACATACTTCTAC / /////// // / / / / BbvI ||||||| |FatI | EcoRII | SfaNI ||||||| CviAII | BssKI Eco57MI ||||||CviRI* BseBI GsuI ||||||NlaIII ScrFI ||||||TseI ||||||NspI |||||BisI ||||BlsI |||NspBII* |||AciI ||BisI |BlsI TauI N G D T P L H V C L E Y G S I S C M K M M A T R R C M Y A W S M A V * V V * R C W R H A A A C M P G V W Q Y K L Y E D A ----:----|----:----|----:----|----:----|----:----|----:----| L P S V G S C T H R S Y P L I L Q I F I * H R C A A A H I G P T H C Y L N Y S S I A V R R Q M Y A Q L I A T Y T T H L H SetI Hin4II* | StyI | MboII | SecI* TspEI | |TspDTI | TspDTI | BslFI | || MnlI SetI | | HphI BseGI FokI | | CviJI \ \\ \ \ \ \ \ \ \ \ \ \ CTTCTCAATGAAGGTGAGGTGTCCTTGGATGATAATGTCAGGGACAAGGGAAATTGGAAG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GAAGAGTTACTTCCACTCCACAGGAACCTACTATTACAGTCCCTGTTCCCTTTAACCTTC / / / / / / / / / / / // | | | SetI SetI | | | BseGI FokI | |CviJI | | MnlI | | SecI* | BslFI | TspDTI | | StyI TspEI | MboII | HphI Hin4II* TspDTI L L N E G E V S L D D N V R D K G N W K F S M K V R C P W M I M S G T R E I G S S Q * R * G V L G * * C Q G Q G K L E A ----:----|----:----|----:----|----:----|----:----|----:----| S R L S P S T D K S S L T L S L P F Q F A E * H L H P T R P H Y H * P C P F N S K E I F T L H G Q I I I D P V L S I P L AclI MaeII | SetI MnlI | TaiI SetI |MseI \ \ \ \\ CCAATAGATGTAGCACAAACGTTTGAAGTAGGTAATATATATTCAAAAGTGTTAAAAGAG 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTATCTACATCGTGTTTGCAAACTTCATCCATTATATATAAGTTTTCACAATTTTCTC / / / / / / | MaeII SetI | | SetI | AclI | MseI TaiI MnlI SetI P I D V A Q T F E V G N I Y S K V L K E Q * M * H K R L K * V I Y I Q K C * K R N R C S T N V * S R * Y I F K S V K R G ----:----|----:----|----:----|----:----|----:----|----:----| G I S T A C V N S T P L I Y E F T N F S A L L H L V F T Q L L Y Y I N L L T L L W Y I Y C L R K F Y T I Y I * F H * F L HphI |TaqII |AsuI* ||NlaIV ||BmgT120I |||CviJI |||HaeIII |||| Tsp4CI* |||| | BsiYI* |||| | | CviRI* SetI |||| | | | Cac8I |Hin4II* |||| | | | | TspDTI BsgI Hpy188I \\ \\\\ \ \ \ \ \ \ \ GTGAAAAAGAAGGGGCCACCGTTGGGTGCAGGCAAAAAACCAAGTTCATTCAGAACTCCT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CACTTTTTCTTCCCCGGTGGCAACCCACGTCCGTTTTTTGGTTCAAGTAAGTCTTGAGGA / / /// / / / / / / Hin4II* | ||| Tsp4CI* | | TspDTI BsgI Hpy188I | ||| BsiYI* | Cac8I | ||AsuI* CviRI* | |BmgT120I | |HaeIII | |CviJI | NlaIV TaqII HphI V K K K G P P L G A G K K P S S F R T P * K R R G H R W V Q A K N Q V H S E L L E K E G A T V G C R Q K T K F I Q N S Y ----:----|----:----|----:----|----:----|----:----|----:----| T F F F P G G N P A P L F G L E N L V G P S F S P A V T P H L C F V L N M * F E H F L L P W R Q T C A F F W T * E S S R AsuI* |BmgT120I || BsrI || | Hin4II* || | | MseI || | | | FatI || | | | |CviAII || | | | || ApoI CviJI ||CviJI | | | || TspEI HaeIII ||HaeIII | | | || EcoRI Hin4II* | MnlI TaqI |||BfiI | | | || NlaIII \ \ \ \ \\\\ \ \ \ \\ \ ATACTAAATGCGAAGGCCACTTTCGAGGACGGGCCTTCCCCAGTTTTAAGCATGAATTCG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TATGATTTACGCTTCCGGTGAAAGCTCCTGCCCGGAAGGGGTCAAAATTCGTACTTAAGC / // / // / / / / // / Hin4II* |MnlI TaqI || BsrI | | | || EcoRI HaeIII |AsuI* | | | || TspEI CviJI BmgT120I | | | || ApoI HaeIII | | | |FatI CviJI | | | CviAII BfiI | | NlaIII | MseI Hin4II* I L N A K A T F E D G P S P V L S M N S Y * M R R P L S R T G L P Q F * A * I R T K C E G H F R G R A F P S F K H E F A ----:----|----:----|----:----|----:----|----:----|----:----| I S F A F A V K S S P G E G T K L M F E * V L H S P W K R P R A K G L K L C S N Y * I R L G S E L V P R G W N * A H I R MwoI Cfr10I |TspDTI TspGWI |HpaII Hin4II* EcoRV \\ \ \\ \ \ CCATATTCGCTCTATTCCAATAATAGTCCGTTGCCGGTATTACCAAGAAGGATATCAACG 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| GGTATAAGCGAGATAAGGTTATTATCAGGCAACGGCCATAATGGTTCTTCCTATAGTTGC / / / // / / | TspDTI TspGWI || Hin4II* EcoRV MwoI |Cfr10I HpaII P Y S L Y S N N S P L P V L P R R I S T H I R S I P I I V R C R Y Y Q E G Y Q R I F A L F Q * * S V A G I T K K D I N A ----:----|----:----|----:----|----:----|----:----|----:----| G Y E S * E L L L G N G T N G L L I D V A M N A R N W Y Y D T A P I V L F S I L W I R E I G I I T R Q R Y * W S P Y * R AciI | MaeIII | | Tsp4CI* | | | MnlI | | | |TfiI | | | |HinfI BseRI | | | || Hpy188I | BsrI \ \ \ \\ \ \ \ CATACAACAAGCGGTAACGGTGGGAATCGGAGGAGTTCTATCACAAATCCAGTATTCAAC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| GTATGTTGTTCGCCATTGCCACCCTTAGCCTCCTCAAGATAGTGTTTAGGTCATAAGTTG / / / // / / AciI | MnlI |Hpy188I | BsrI Tsp4CI* HinfI BseRI MaeIII TfiI H T T S G N G G N R R S S I T N P V F N I Q Q A V T V G I G G V L S Q I Q Y S T Y N K R * R W E S E E F Y H K S S I Q P ----:----|----:----|----:----|----:----|----:----|----:----| C V V L P L P P F R L L E I V F G T N L A Y L L R Y R H S D S S N * * L D L I * M C C A T V T P I P P T R D C I W Y E V BsmAI | AluI | CviJI | |AvaI | |XhoI | |SmlI TspGWI | ||TaqI | AluI | ||SetI SetI | CviJI | ||BmeT110I | AccI | | SetI | |||Hpy178III* | |Hpy166II | | | ApoI | ||||BdaI | || Tsp4CI* | | | TspEI | ||||BdaI \ \\ \ \ \ \ \ \ \\\\\ CCACGAAAACCAACCTTGTCTACGGACAGTTTTTCGTCAAGCTCAAATTCCAGCTCGAGA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| GGTGCTTTTGGTTGGAACAGATGCCTGTCAAAAAGCAGTTCGAGTTTAAGGTCGAGCTCT / // / / / / / / / / // SetI |AccI Tsp4CI* | | CviJI | | | | |Hpy178III* Hpy166II | | AluI | | | | |SmlI | SetI | | | | |XhoI TspGWI | | | | |AvaI | | | | BmeT110I | | | | TaqI | | | BsmAI | | | BdaI | | | BdaI | | CviJI | | AluI | SetI TspEI ApoI P R K P T L S T D S F S S S S N S S S R H E N Q P C L R T V F R Q A Q I P A R D T K T N L V Y G Q F F V K L K F Q L E T ----:----|----:----|----:----|----:----|----:----|----:----| G R F G V K D V S L K E D L E F E L E L G V F V L R T * P C N K T L S L N W S S W S F W G Q R R V T K R * A * I G A R S Hpy166II | GsuI | Eco57MI | | MaeII | | |MlyI | | |PleI | | ||BccI | | |||SetI | | |||TaiI | | ||||Hpy178III* | | ||||| HinfI | | ||||| | BsrI AluI | | ||||| | BdaI CviJI DdeI | | ||||| | BdaI SetI Hin4I | SetI \ \ \ \\\\\ \ \ \ \ \ \ CTAAGAGTGAACTCCATCAACGTCAAGACTCCAGTAGGTGTGTCGCCCAAGAAAGAGCTT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| GATTCTCACTTGAGGTAGTTGCAGTTCTGAGGTCATCCACACAGCGGGTTCTTTCTCGAA / / / / /// / // / / / / DdeI | | | ||| | || SetI Hin4I | CviJI | | | ||| | |HinfI | AluI | | | ||| | BdaI SetI | | | ||| | BdaI | | | ||| | BsrI | | | ||| Hpy178III* | | | ||BccI | | | |MaeII | | | |PleI | | | MlyI | | TaiI | | SetI | Eco57MI | GsuI Hpy166II L R V N S I N V K T P V G V S P K K E L * E * T P S T S R L Q * V C R P R K S L K S E L H Q R Q D S S R C V A Q E R A C ----:----|----:----|----:----|----:----|----:----|----:----| S L T F E M L T L V G T P T D G L F S S V L L S S W * R * S E L L H T A W S L A * S H V G D V D L S W Y T H R G L F L K Hpy188I | Csp6I | |RsaI | || Hin4I | || | Tsp4CI* |TfiI || | | CviRI* BtgZI |HinfI || | | | TspRI | AciI FnuDII* \\ \\ \ \ \ \ \ \ \ GTATCTGAATCAGTACGACACAGTGCAACACCAACAAGTCCGCACAACAACATCGCGTTG 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CATAGACTTAGTCATGCTGTGTCACGTTGTGGTTGTTCAGGCGTGTTGTTGTAGCGCAAC / / /// / / / / / / | | ||| | | CviRI* | AciI FnuDII* | | ||| | Tsp4CI* BtgZI | | ||| TspRI | | ||Csp6I | | |RsaI | | Hin4I | HinfI | TfiI Hpy188I V S E S V R H S A T P T S P H N N I A L Y L N Q Y D T V Q H Q Q V R T T T S R * I * I S T T Q C N T N K S A Q Q H R V D ----:----|----:----|----:----|----:----|----:----|----:----| T D S D T R C L A V G V L G C L L M A N Q I Q I L V V C H L V L L D A C C C R T Y R F * Y S V T C C W C T R V V V D R Q BsrDI |MnlI ||MaeII ||| SetI ||| TaiI ||| BsmAI MseI ||| | MlyI VspI ||| | PleI HinfI BseRI \ \\\ \ \ \ \ ATTAATAGATACTTGTTGCCTAACAAGAGCAATGACAACGTGAGAGGAGACTCACAGACA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TAATTATCTATGAACAACGGATTGTTCTCGTTACTGTTGCACTCTCCTCTGAGTGTCTGT / / // / /// / / / VspI | || | ||BsmAI | | SetI MseI | || | |PleI | BseRI | || | MlyI HinfI | || MaeII | |TaiI | |SetI | MnlI BsrDI I N R Y L L P N K S N D N V R G D S Q T L I D T C C L T R A M T T * E E T H R Q * * I L V A * Q E Q * Q R E R R L T D S ----:----|----:----|----:----|----:----|----:----|----:----| I L L Y K N G L L L L S L T L P S E C V S * Y I S T A * C S C H C R S L L S V S N I S V Q Q R V L A I V V H S S V * L C Tsp4CI* | AciI | |BisI | ||BlsI | |||AciI | |||TauI | ||||BisI | |||||BlsI | ||||||TauI | |||||||SfaNI AluI | |||||||| MwoI SfeI* CviJI | |||||||| | AciI | HphI | SetI | |||||||| | |BsrDI | | XcmI \ \ \ \\\\\\\\ \ \\ \ \ \ GCTACAATCAACGATGACGGTGGCGGCGGCAATGGCGGTGATGCCACTATAGGAATGGGA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CGATGTTAGTTGCTACTGCCACCGCCGCCGTTACCGCCACTACGGTGATATCCTTACCCT / / /////// / / / // CviJI | ||||||MwoI | AciI | |SfeI* AluI | |||||BisI BsrDI | XcmI | |||||AciI SfaNI HphI | ||||BlsI | |||TauI | ||BisI | ||AciI | |BlsI | TauI Tsp4CI* A T I N D D G G G G N G G D A T I G M G L Q S T M T V A A A M A V M P L * E W D Y N Q R * R W R R Q W R * C H Y R N G T ----:----|----:----|----:----|----:----|----:----|----:----| A V I L S S P P P P L P P S A V I P I P L * L * R H R H R R C H R H H W * L F P S C D V I V T A A A I A T I G S Y S H S AsuI* AvaII DraII PpuMI |BmgT120I ||BssKI ||NlaIV ||BslFI ||| HpaII TatI SetI ||| ScrFI |Csp6I |Hpy166II DdeI ||| CauII* ||RsaI MseI || MnlI \ \\\ \ \\\ \ \\ \ CTAAGAAAGGACCCGGACGATGAGAACGAGAACAAGTACAAGATTAAGGTAAACAATGGC 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| GATTCTTTCCTGGGCCTGCTACTCTTGCTCTTGTTCATGTTCTAATTCCATTTGTTACCG / // /// /// / / / DdeI || ||BssKI ||TatI MseI | MnlI || |BslFI |Csp6I SetI Hpy166II || |HpaII RsaI || CauII* || ScrFI |PpuMI |DraII |AvaII |AsuI* BmgT120I NlaIV L R K D P D D E N E N K Y K I K V N N G * E R T R T M R T R T S T R L R * T M A K K G P G R * E R E Q V Q D * G K Q W R ----:----|----:----|----:----|----:----|----:----|----:----| S L F S G S S S F S F L Y L I L T F L P V L F P G P R H S R S C T C S * P L C H * S L V R V I L V L V L V L N L Y V I A PshAI Cac8I | MaeIII | Esp3I | Tsp45I | BsmAI | | BseRI BccI | CviJI | | | Hpy188I TspEI | |SecI* | | | | NmeAIII | MseI \ \\ \ \ \ \ \ \ \ GAGCCGAGGAGACGAGTGTCACTTCTGAACATACCCATCTCAAAATTAAGAAATAGCAAT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CTCGGCTCCTCTGCTCACAGTGAAGACTTGTATGGGTAGAGTTTTAATTCTTTATCGTTA / / // / / / / / / // | | |SecI* | | | | NmeAIII | |MseI | | BsmAI | | | Hpy188I | TspEI | | Esp3I | | Tsp45I BccI | CviJI | | MaeIII Cac8I | BseRI PshAI E P R R R V S L L N I P I S K L R N S N S R G D E C H F * T Y P S Q N * E I A I A E E T S V T S E H T H L K I K K * Q * ----:----|----:----|----:----|----:----|----:----|----:----| S G L L R T D S R F M G M E F N L F L L R A S S V L T V E S C V W R L I L F Y C L R P S S H * K Q V Y G D * F * S I A I MluI AflIII | FnuDII* | | Cac8I | | | CviRI* \ \ \ \ AACACGCGTGCAGAAGATTGA 1270 1280 ----:----|----:----|- TTGTGCGCACGTCTTCTAACT / / / | | CviRI* | AflIII | Cac8I | MluI FnuDII* N T R A E D * T R V Q K I X H A C R R L X ----:----|----:----|- L V R A S S Q Y C A H L L N V R T C F I S # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 9 BspACI,SsiI AclI 1 Psp1406I AflIII 1 AhaIII* 1 DraI AluI 5 AluBI ApoI 2 AcsI,XapI AsuI* 3 Cfr13I,PspPI,Sau96I,AspS9I AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BarI 1 BbvI 1 BseXI,BstV1I,Lsp1109I BccI 5 BdaI 2 BetI* 1 BsaWI BfiI 1 BmrI,BmuI BisI 4 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 4 BmeT110I 1 BmgT120I 3 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 3 BstF5I,BtsCI BseMII 3 BseRI 3 BseSI 2 BaeGI,BstSLI BseYI 1 BsgI 1 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmAI 3 Alw26I,BstMAI BspCNI 3 BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrDI 2 BseMI,Bse3DI BsrI 3 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BtgZI 2 Cac8I 4 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I Cfr10I 1 BsrFI,BssAI,Bse118I Csp6I 2 CviQI,RsaNI CviAII 5 CviJI 13 CviKI-1 CviRI* 6 HpyCH4V DdeI 5 BstDEI,HpyF3I DraII 1 EcoO109I DsaI* 1 BtgI,BstDSI Eco57MI 2 EcoRI 1 EcoRII 1 AjnI,Psp6I,PspGI EcoRV 1 Eco32I Esp3I 1 BsmBI FatI 5 FauI 1 SmuI FnuDII* 4 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 3 GsaI 1 GsuI 2 BpmI HaeIII 3 BsnI,BsuRI,BshFI,PhoI HgiJII* 2 Eco24I,EcoT38I,FriOI,BanII Hin4I 2 Hin4II* 6 HpyAV HinfI 7 HpaII 3 HapII,BsiSI,MspI HphI 3 AsuHPI Hpy166II 3 Hpy8I Hpy178III* 3 Hpy188III Hpy188I 6 Hpy99I 1 MaeII 3 HpyCH4IV MaeIII 2 MboII 2 MluI 1 MlyI 4 SchI MnlI 8 MseI 8 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 3 HpyF10VI,BstMWI NcoI 1 Bsp19I NlaIII 5 Hin1II,Hsp92II,FaeI NlaIV 2 BspLI,BmiI,PspN4I NmeAIII 1 NspBII* 2 MspA1I NspI 2 BstNSI,XceI OliI 1 AleI PleI 4 PpsI PpuMI 1 Psp5II,PspPPI PshAI 1 BstPAI,BoxI PsrI 1 PvuII 1 RsaI 2 AfaI ScrFI 2 BmrFI,MspR9I,Bme1390I SduI 4 MhlI,Bsp1286I SecI* 3 BseDI,BssECI,BsaJI SetI 19 SfaNI 2 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 1 SmoI StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 3 TaqI 2 TaqII 1 TatI 1 TauI 3 TfiI 3 PfeI TseI 1 ApeKI TsoI 1 Tsp45I 1 NmuCI Tsp4CI* 5 HpyCH4III,TaaI,Bst4CI TspDTI 8 TspEI 7 TasI,Tsp509I,Sse9I TspGWI 4 TspRI 1 TscAI VspI 2 PshBI,AseI XcmI 1 XhoI 1 Sfr274I,SlaI,StrI,TliI,PaeR7I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AcyI AflII AgeI AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuII AvrII BaeI BalI BamHI BbvCI BbvII* Bce83I* BceAI BcgI BciVI BclI BglI BglII BinI* BmtI BplI Bpu10I BsaAI BsaBI BsaXI BsePI BsmI Bsp120I Bsp1407I BspHI BspLU11I* BspMI BspOI BsrBI BssNAI Bst1107I BstAPI BstEII BstKTI BstXI BstZ17I BtrI BtsI Cfr9I CfrI ClaI CspCI DinI DpnI DraIII DrdI Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I EcoICRI EcoNI EcoP15I EcoT22I EgeI EheI EspI* FalI FseI FspAI GlaI HaeII HgaI HgiAI* HgiCI* HhaI Hin6I HindII HindIII HinP1I HpaI HspAI KasI KpnI Ksp632I* MaeI MauBI MboI McrI* MfeI MmeI Mph1103I MroNI MstI* NaeI NarI NdeI NgoMIV NheI NotI NruI NsiI PacI PasI PflMI PfoI PmaCI PmeI PpiI PsiI PspOMI PspXI PstI PvuI RsrII SacI SacII SalI SanDI SapI SauI* ScaI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TspMI TstI Tth111I XbaI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769