Restriction Map of CYC1/YJR048W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

CYC1/YJR048W on chromosome X from coordinates 526335 to 526664.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.26936

CviJI Cfr10I HaeIII |HpaII Hpy178III* ApoI || MwoI | MaeI TspEI || | BdaI Hin4I | | Eam1105I EcoRI || | |DdeI SetI Hin4I | | | AccI \ \\ \ \\ \ \ \ \ \ \ ATGACTGAATTCAAGGCCGGTTCTGCTAAGAAAGGTGCTACACTTTTCAAGACTAGATGT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTGACTTAAGTTCCGGCCAAGACGATTCTTTCCACGATGTGAAAAGTTCTGATCTACA / / // / / / / / / | | || BdaI | SetI Hin4I | Eam1105I | | |Cfr10I DdeI Hin4I | MaeI | | HpaII Hpy178III* | | MwoI | HaeIII | CviJI EcoRI TspEI ApoI M T E F K A G S A K K G A T L F K T R C * L N S R P V L L R K V L H F S R L D V D * I Q G R F C * E R C Y T F Q D * M S ----:----|----:----|----:----|----:----|----:----|----:----| X V S N L A P E A L F P A V S K L V L H X S Q I * P R N Q * S L H * V K * S * I H S F E L G T R S L F T S C K E L S S T AsuI* SecI* |CviJI DsaI* |HaeIII Hin4I |BmgT120I Hin4I || BsiYI* |PflMI || | SetI FatI |DraIII || | | AsuI* CviRI* |BsiYI* || | | AvaII |CviAII Hpy166II |Tsp4CI* || | | |BmgT120I || NlaIII \ \\ \\ \ \ \\ \\ \ CTACAATGCCACACCGTGGAAAAGGGTGGCCCACATAAGGTTGGTCCAAACTTGCATGGT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GATGTTACGGTGTGGCACCTTTTCCCACCGGGTGTATTCCAACCAGGTTTGAACGTACCA // / / / / /// / / // / // |AccI | | | DsaI* ||| | SetI |AvaII | |FatI | | | | SecI* ||| BsiYI* |AsuI* | CviAII | | | Tsp4CI* ||AsuI* BmgT120I CviRI* | | BsiYI* |BmgT120I NlaIII | | DraIII HaeIII | | PflMI CviJI | Hin4I | Hin4I Hpy166II L Q C H T V E K G G P H K V G P N L H G Y N A T P W K R V A H I R L V Q T C M V T M P H R G K G W P T * G W S K L A W Y ----:----|----:----|----:----|----:----|----:----|----:----| R C H W V T S F P P G C L T P G F K C P D V I G C R P F P H G V Y P Q D L S A H * L A V G H F L T A W M L N T W V Q M T SfaNI | Csp6I Hin4II* | |RsaI | AluI | ||Hpy166II | CviJI | ||| Eco57I DrdI | | SetI | ||| Eco57MI Hpy178III* \ \ \ \ \ \\\ \ \ ATCTTTGGCAGACACTCTGGTCAAGCTGAAGGGTATTCGTACACAGATGCCAATATCAAG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TAGAAACCGTCTGTGAGACCAGTTCGACTTCCCATAAGCATGTGTCTACGGTTATAGTTC / / / / // / / DrdI | | CviJI || Eco57MI Hpy178III* | | AluI || Eco57I | SetI |Hpy166II Hin4II* |Csp6I SfaNI RsaI I F G R H S G Q A E G Y S Y T D A N I K S L A D T L V K L K G I R T Q M P I S R L W Q T L W S S * R V F V H R C Q Y Q E ----:----|----:----|----:----|----:----|----:----|----:----| I K P L C E P * A S P Y E Y V S A L I L Y R Q C V S Q D L Q L T N T C L H W Y * D K A S V R T L S F P I R V C I G I D L FatI AflIII BspLU11I* |CviAII ||BslFI ||| NspI ||| NlaIII ||| | Hpy188I MaeII ||| | | TatI AflIII ||| | | |Csp6I | SetI ||| | | ||RsaI | TaiI ||| | | ||ScaI \ \ \\\ \ \ \\\ AAAAACGTGTTGTGGGACGAAAATAACATGTCAGAGTACTTGACTAACCCAAAGAAATAT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTGCACAACACCCTGCTTTTATTGTACAGTCTCATGAACTGATTGGGTTTCTTTATA / / / / // / /// / | | AflIII | || | ||TatI FalI | MaeII | || | |Csp6I FalI TaiI | || | ScaI SetI | || | RsaI | || Hpy188I | || BslFI | |BspLU11I* | |AflIII | |FatI | CviAII NlaIII NspI K N V L W D E N N M S E Y L T N P K K Y K T C C G T K I T C Q S T * L T Q R N I K R V V G R K * H V R V L D * P K E I Y ----:----|----:----|----:----|----:----|----:----|----:----| F F T N H S S F L M D S Y K V L G F F Y S F R T T P R F Y C T L T S S * G L S I F V H Q P V F I V H * L V Q S V W L F I BssKI EcoRII |FalI |FalI ||ScrFI ||BseBI ||| Acc65I ||| HgiCI* ||| |Csp6I ||| ||BccI BsiYI* ||| ||RsaI | Hin4II* ||| ||NlaIV CviJI | | FalI MseI ||| ||| KpnI HaeIII | | FalI MboII |TspEI \\\ \\\ \ \ \ \ \ \ \\ ATTCCTGGTACCAAGATGGCCTTTGGTGGGTTGAAGAAGGAAAAAGACAGAAACGACTTA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGGACCATGGTTCTACCGGAAACCACCCAACTTCTTCCTTTTTCTGTCTTTGCTGAAT ////// / / / / / / |||||HgiCI* | | | FalI MboII MseI |||||Acc65I | | | FalI ||||Csp6I | | Hin4II* ||||BccI | BsiYI* |||NlaIV HaeIII |||RsaI CviJI ||EcoRII ||BssKI |KpnI BseBI ScrFI I P G T K M A F G G L K K E K D R N D L F L V P R W P L V G * R R K K T E T T * S W Y Q D G L W W V E E G K R Q K R L N ----:----|----:----|----:----|----:----|----:----|----:----| I G P V L I A K P P N F F S F S L F S K Y E Q Y W S P R Q H T S S P F L C F R S N R T G L H G K T P Q L L F F V S V V * CviJI SetI | BdaI \ \ \ ATTACCTACTTGAAAAAAGCCTGTGAGTAA 310 320 330 ----:----|----:----|----:----| TAATGGATGAACTTTTTTCGGACACTCATT / / TspEI CviJI SetI BdaI I T Y L K K A C E * L P T * K K P V S X Y L L E K S L * V X ----:----|----:----|----:----| I V * K F F A Q S Y L * R S S F L R H T N G V Q F F G T L L # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AccI 1 FblI,XmiI AflIII 2 AluI 1 AluBI ApoI 1 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BccI 1 BdaI 1 BmgT120I 2 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BsiYI* 3 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BspLU11I* 1 PscI,PciI BssKI 1 BstSCI,StyD4I Cfr10I 1 BsrFI,BssAI,Bse118I Csp6I 3 CviQI,RsaNI CviAII 2 CviJI 5 CviKI-1 CviRI* 1 HpyCH4V DdeI 1 BstDEI,HpyF3I DraIII 1 AdeI DrdI 1 AasI,DseDI DsaI* 1 BtgI,BstDSI Eam1105I 1 AspEI,BmeRI,DriI,AhdI Eco57I 1 AcuI Eco57MI 1 EcoRI 1 EcoRII 1 AjnI,Psp6I,PspGI FalI 2 FatI 2 HaeIII 3 BsnI,BsuRI,BshFI,PhoI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I Hin4I 2 Hin4II* 2 HpyAV HpaII 1 HapII,BsiSI,MspI Hpy166II 2 Hpy8I Hpy178III* 2 Hpy188III Hpy188I 1 KpnI 1 MaeI 1 FspBI,BfaI,XspI MaeII 1 HpyCH4IV MboII 1 MseI 1 Tru1I,Tru9I MwoI 1 HpyF10VI,BstMWI NlaIII 2 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I NspI 1 BstNSI,XceI PflMI 1 BasI,AccB7I,Van91I RsaI 3 AfaI ScaI 1 BmcAI,AssI,ZrmI ScrFI 1 BmrFI,MspR9I,Bme1390I SecI* 1 BseDI,BssECI,BsaJI SetI 5 SfaNI 1 LweI TaiI 1 TatI 1 Tsp4CI* 1 HpyCH4III,TaaI,Bst4CI TspEI 2 TasI,Tsp509I,Sse9I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AciI AclI AcyI AflII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI AsuII AvaI AvrII BaeI BalI BamHI BarI BbvCI BbvI BbvII* Bce83I* BceAI BcgI BciVI BclI BetI* BfiI BglI BglII BinI* BisI BlsI BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseGI BseMII BsePI BseRI BseSI BseYI BsgI BsiI* BsmAI BsmI Bsp120I Bsp1407I BspCNI BspHI BspMI BspMII* BspOI BsrBI BsrDI BsrI BssNAI Bst1107I BstAPI BstEII BstF5I BstKTI BstXI BstZ17I BtgZI BtrI BtsCI BtsI Cac8I CauII* Cfr9I CfrI ClaI CspCI DinI DpnI DraII EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoP15I EcoRV EcoT22I EgeI EheI Esp3I EspI* FauI Fnu4HI FnuDII* FokI FseI FspAI GlaI GsaI GsuI HaeII HgaI HgiAI* HgiJII* HhaI Hin6I HindII HindIII HinfI HinP1I HpaI HphI Hpy99I HspAI KasI Ksp632I* MaeIII MauBI MboI McrI* MfeI MluI MlyI MmeI MnlI Mph1103I MroNI MslI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* OliI PacI PasI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* SchI SduI SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyI SwaI TaqI TaqII TauI TfiI TseI TsoI Tsp45I TspDTI TspGWI TspMI TspRI TstI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769