Restriction Map of GUT2/YIL155C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

GUT2/YIL155C on chromosome IX from coordinates 53708 to 51759.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.2509

EMBOSS_001 BbvI |TseI |AluI |CviJI ||BisI |||BbvI |||BlsI |||SetI ||||Cfr10I |||||HpaII |||||MboII |||||| MwoI |||||| |MboII |||||| || TseI |||||| || MwoI |||||| || CviRI* |||||| || |BisI |||||| || ||BlsI |||||| || |||TseI |||||| || |||AluI |||||| || |||CviJI |||||| || |||PvuII |||||| || |||NspBII* |||||| || ||||BisI |||||| || |||||BlsI |||||| || |||||SetI |||||| || ||||||TseI |||||| || ||||||MwoI |||||| || ||||||AlwNI |||||| || ||||||BstAPI |||||| || |||||||BisI |||||| || ||||||||BlsI |||||| || ||||||||| FatI |||||| || ||||||||| NcoI |||||| || ||||||||| StyI |||||| || ||||||||| SecI* |||||| || ||||||||| DsaI* |||||| || ||||||||| |CviAII |||||| || ||||||||| ||MwoI |||||| || ||||||||| ||BbvI |||||| || ||||||||| |||CfrI |||||| || ||||||||| ||||NlaIII |||||| || ||||||||| |||||BalI |||||| || ||||||||| |||||CviJI MaeIII |||||| || ||||||||| |||||HaeIII |EcoP15I |||||| || ||||||||| |||||| BsgI || BbvI |||||| || ||||||||| |||||| | CviJI || | SapI |||||| || ||||||||| |||||| | |SecI* || | Ksp632I* |||||| || ||||||||| |||||| | |DsaI* \\ \ \ \\\\\\ \\ \\\\\\\\\ \\\\\\ \ \\ ATGTTTTCGGTAACGAGAAGAAGAGCTGCCGGTGCAGCTGCTGCCATGGCCACAGCCACG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAAAAGCCATTGCTCTTCTTCTCGACGGCCACGTCGACGACGGTACCGGTGTCGGTGC / / / / / //// // /////////// ///// / / | | | | | |||| || ||||||||||| ||||| | DsaI* | | | | | |||| || ||||||||||| ||||| | SecI* | | | | | |||| || ||||||||||| ||||| CviJI | | | | | |||| || ||||||||||| ||||BsgI | | | | | |||| || ||||||||||| ||||CfrI | | | | | |||| || ||||||||||| |||BbvI | | | | | |||| || ||||||||||| ||HaeIII | | | | | |||| || ||||||||||| ||CviJI | | | | | |||| || ||||||||||| ||BalI | | | | | |||| || ||||||||||| |DsaI* | | | | | |||| || ||||||||||| |SecI* | | | | | |||| || ||||||||||| |StyI | | | | | |||| || ||||||||||| |NcoI | | | | | |||| || ||||||||||| |FatI | | | | | |||| || ||||||||||| CviAII | | | | | |||| || ||||||||||NlaIII | | | | | |||| || |||||||||MwoI | | | | | |||| || |||||||||TseI | | | | | |||| || ||||||||BisI | | | | | |||| || |||||||BlsI | | | | | |||| || ||||||TseI | | | | | |||| || |||||BisI | | | | | |||| || ||||BlsI | | | | | |||| || |||NspBII* | | | | | |||| || |||BstAPI | | | | | |||| || |||PvuII | | | | | |||| || |||AlwNI | | | | | |||| || |||CviJI | | | | | |||| || |||MwoI | | | | | |||| || |||TseI | | | | | |||| || |||AluI | | | | | |||| || ||BisI | | | | | |||| || |BlsI | | | | | |||| || |SetI | | | | | |||| || CviRI* | | | | | |||| |Cfr10I | | | | | |||| MboII | | | | | |||| HpaII | | | | | |||| MwoI | | | | | |||| BbvI | | | | | |||MboII | | | | | |||MwoI | | | | | |||TseI | | | | | |||BbvI | | | | | ||BisI | | | | | |BlsI | | | | | CviJI | | | | | AluI | | | | SetI | | | Ksp632I* | | | SapI | | BbvI | MaeIII EcoP15I M F S V T R R R A A G A A A A M A T A T C F R * R E E E L P V Q L L P W P Q P R V F G N E K K S C R C S C C H G H S H G ----:----|----:----|----:----|----:----|----:----|----:----| X N E T V L L L A A P A A A A M A V A V X T K P L S F F L Q R H L Q Q W P W L W H K R Y R S S S S G T C S S G H G C G R TatI |Csp6I ||RsaI ||| HgaI CviJI ||| | BslFI HaeIII ||| | |BsrI |TsoI ||| | || MaeI || HphI ||| | || BseGI || | MwoI ||| | || |BceAI || | |ApaLI ||| | || || CviJI || | || CviRI* ||| | || || |StyI || | || Hpy166II AvaI ||| | || || |SecI* || | || | SduI |BmeT110I ||| | || || || FokI || | || | BseSI || AluI ||| | || || || | SetI || | || | HgiAI* || CviJI \\\ \ \\ \\ \\ \ \ \\ \ \\ \ \ \\ \ GGGACGCTGTACTGGATGACTAGCCAAGGTGATAGGCCGTTAGTGCACAATGACCCGAGC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CCCTGCGACATGACCTACTGATCGGTTCCACTATCCGGCAATCACGTGTTACTGGGCTCG /// / /// // / / / // / / / / /// ||| | ||| || | | | || | | | ApaLI ||CviJI ||| | ||| || | | | || | | Hpy166II ||AluI ||| | ||| || | | | || | | CviRI* |AvaI ||| | ||| || | | | || | HgiAI* BmeT110I ||| | ||| || | | | || | BseSI SetI ||| | ||| || | | | || | SduI ||| | ||| || | | | || HphI ||| | ||| || | | | || MwoI ||| | ||| || | | | |HaeIII ||| | ||| || | | | |CviJI ||| | ||| || | | | TsoI ||| | ||| || | | FokI ||| | ||| || | SecI* ||| | ||| || | StyI ||| | ||| || SetI ||| | ||| |CviJI ||| | ||| |BceAI ||| | ||| MaeI ||| | ||BslFI ||| | |BseGI ||| | HgaI ||| BsrI ||TatI |Csp6I RsaI G T L Y W M T S Q G D R P L V H N D P S G R C T G * L A K V I G R * C T M T R A D A V L D D * P R * * A V S A Q * P E L ----:----|----:----|----:----|----:----|----:----|----:----| P V S Y Q I V L W P S L G N T C L S G L P S A T S S S * G L H Y A T L A C H G S P R Q V P H S A L T I P R * H V I V R A SetI |BsaXI SetI AciI ||XbaI |FatI | AciI |||MaeI ||CviAII | BisI |||TstI ||| NlaIII | |BlsI |||BsmAI SetI ||| | TstI | |BspMI |||Eco31I | AsuI* ||| | BsaXI | |EcoP15I |||Hpy178III* | AvaII ||| | CviRI* | ||TauI ||||BsmAI | |BmgT120I ||| | |TspEI | ||BsrBI AciI ||||Eco31I | ||BspMI \\\ \ \\ \ \\\ \ \\\\\ \ \\\ TACATGGTGCAATTCCCCACCGCCGCTCCACCGCAGGTCTCTAGACGAGACCTGCTGGAC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTACCACGTTAAGGGGTGGCGGCGAGGTGGCGTCCAGAGATCTGCTCTGGACGACCTG / /// / / ///// / // / //// / // | ||| | TspEI ||||| | || BsaXI |||| SetI |Tsp4CI* | ||| CviRI* ||||| | || TstI |||Eco31I |AvaII | ||BsaXI ||||| | |SetI |||BsmAI |AsuI* | ||FatI ||||| | AciI ||Eco31I BmgT120I | |CviAII ||||| BspMI ||BsmAI | TstI ||||EcoP15I |XbaI NlaIII |||BsrBI Hpy178III* |||AciI MaeI ||BisI |BlsI AciI TauI Y M V Q F P T A A P P Q V S R R D L L D T W C N S P P P L H R R S L D E T C W T H G A I P H R R S T A G L * T R P A G P ----:----|----:----|----:----|----:----|----:----|----:----| * M T C N G V A A G G C T E L R S R S S S C P A I G W R R E V A P R * V L G A P V H H L E G G G S W R L D R S S V Q Q V TspEI | HgaI | | TaqI | | |SfaNI | | || MaeII | | || AflIII | | || |BtrI AciI | | || ||Hpy99I | AsuI* | | || |||SetI | |TstI | | || |||TaiI | |NlaIV Tsp4CI* | | || |||| MboI | |BmgT120I | CfrI | | || |||| BclI | ||CviJI | | BalI | | || |||| | DpnI | ||HaeIII | | CviJI | | || |||| | |BstKTI | |||SecI* | | HaeIII | | || |||| | || FauI | |||DsaI* \ \ \ \ \ \\ \\\\ \ \\ \ \ \\\\ CGTCTGGCCAAGACGCATCAATTCGACGTGTTGATCATCGGTGGCGGGGCCACGGGGACA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GCAGACCGGTTCTGCGTAGTTAAGCTGCACAACTAGTAGCCACCGCCCCGGTGCCCCTGT / / / / //// / // / / / / /// / | | CfrI | |||| | || | | | | ||| DsaI* | HaeIII | |||| | || | | | | ||| SecI* | CviJI | |||| | || | | | | ||AsuI* | BalI | |||| | || | | | | |BmgT120I BspMI | |||| | || | | | | |HaeIII | |||| | || | | | | |CviJI | |||| | || | | | | NlaIV | |||| | || | | | AciI | |||| | || | | TstI | |||| | || | FauI | |||| | || BclI | |||| | || MboI | |||| | |DpnI | |||| | BstKTI | |||| AflIII | |||SfaNI | |||MaeII | ||BtrI | |HgaI | TaqI | TaiI | SetI Hpy99I TspEI R L A K T H Q F D V L I I G G G A T G T V W P R R I N S T C * S S V A G P R G Q S G Q D A S I R R V D H R W R G H G D R ----:----|----:----|----:----|----:----|----:----|----:----| R R A L V C * N S T N I M P P P A V P V G D P W S A D I R R T S * R H R P W P S T Q G L R M L E V H Q D D T A P G R P C BbvI SfaNI | BseGI | | SduI | | BseSI | | BslFI | | |MaeI | | || MwoI | | || |FokI | | || || TseI | | || || |BisI | | || || ||BlsI | | || || ||| TstI | | || || ||| TstI | | || || ||| | BssKI | | || || ||| | EcoRII | | || || ||| | |MlyI | | || || ||| | |PleI AsuI* | | || || ||| | |SecI* |CviJI | | || || ||| | ||ScrFI |HaeIII | | || || ||| | ||BseBI |BmgT120I Hin4I | | || || ||| | ||| HinfI ||BslFI | TstI \ \ \\ \\ \\\ \ \\\ \ \\\ \ \ GGATGTGCCCTAGATGCTGCGACCAGGGGACTCAATGTGGCCCTTGTTGAAAAGGGGGAT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CCTACACGGGATCTACGACGCTGGTCCCCTGAGTTACACCGGGAACAACTTTTCCCCCTA / / / // / /// /// / / /// // / | | | || | ||| ||| | HinfI ||| || TstI | | | || | ||| ||| EcoRII ||| |BslFI | | | || | ||| ||| BssKI ||| Hin4I | | | || | ||| ||| SecI* ||AsuI* | | | || | ||| ||BseBI |BmgT120I | | | || | ||| ||ScrFI HaeIII | | | || | ||| |PleI CviJI | | | || | ||| MlyI | | | || | ||TseI | | | || | |FokI | | | || | |BisI | | | || | BlsI | | | || TstI | | | || TstI | | | |BslFI | | | MaeI | | MwoI | SfaNI | BbvI BseGI BseSI SduI G C A L D A A T R G L N V A L V E K G D D V P * M L R P G D S M W P L L K R G I M C P R C C D Q G T Q C G P C * K G G F ----:----|----:----|----:----|----:----|----:----|----:----| P H A R S A A V L P S L T A R T S F P S L I H G L H Q S W P V * H P G Q Q F P P S T G * I S R G P S E I H G K N F L P I SecI* |AvaI ||BmeT110I |||Hpy178III* |||| MaeII |||| | MnlI AciI |||| | |SetI | Csp6I |||| | |TaiI | |RsaI |||| | || Hpy99I TfiI | || DdeI |||| | || | Hin4I HinfI Tsp4CI* | || Hin4II* \\\\ \ \\ \ \ \ \ \ \\ \ TTTGCCTCGGGAACGTCGTCCAAATCTACCAAGATGATTCACGGTGGGGTGCGGTACTTA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| AAACGGAGCCCTTGCAGCAGGTTTAGATGGTTCTACTAAGTGCCACCCCACGCCATGAAT // ///// / / / // / || ||||Hin4I | Tsp4CI* | || DdeI || |||MaeII HinfI | |Hin4II* || ||MnlI TfiI | |Csp6I || |Hpy99I | RsaI || TaiI AciI || SetI |Hpy178III* |AvaI BmeT110I SecI* F A S G T S S K S T K M I H G G V R Y L L P R E R R P N L P R * F T V G C G T * C L G N V V Q I Y Q D D S R W G A V L R ----:----|----:----|----:----|----:----|----:----|----:----| K A E P V D D L D V L I I * P P T R Y K N Q R P F T T W I * W S S E R H P A T S K G R S R R G F R G L H N V T P H P V * MboI XhoII | DpnI | BsrI StuI | |BstKTI XmnI Hin4II* | || MnlI CviJI | StyI | || | BinI* HaeIII | SecI* XcmI | || | | TaqI \ \ \ \ \ \\ \ \ \ GAGAAGGCCTTCTGGGAGTTCTCCAAGGCACAACTGGATCTGGTCATCGAGGCACTCAAC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTTCCGGAAGACCCTCAAGAGGTTCCGTGTTGACCTAGACCAGTAGCTCCGTGAGTTG / / / / /// // / / HaeIII Hin4II* | XcmI ||| || | TaqI CviJI SecI* ||| || BinI* XmnI StyI ||| |MnlI StuI ||| XhoII ||| MboI ||DpnI |BstKTI BsrI E K A F W E F S K A Q L D L V I E A L N R R P S G S S P R H N W I W S S R H S T E G L L G V L Q G T T G S G H R G T Q R ----:----|----:----|----:----|----:----|----:----|----:----| S F A K Q S N E L A C S S R T M S A S L L S P R R P T R W P V V P D P * R P V * L L G E P L E G L C L Q I Q D D L C E V SetI |ApaLI || MnlI || CviRI* || Hpy166II TspEI || |BsiYI* |BinI* || ||SduI || MboI || ||BseSI || Hpy188I BtsI || ||HgiAI* || | DpnI Hpy166II | HphI TspRI || ||| Tsp4CI* || | |BstKTI \ \ \ \ \\ \\\ \ \\ \ \\ GAGCGTAAACATCTTATCAACACTGCCCCTCACCTGTGCACGGTGCTACCAATTCTGATC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CTCGCATTTGTAGAATAGTTGTGACGGGGAGTGGACACGTGCCACGATGGTTAAGACTAG / / / / /// // / // // / Hpy166II | HphI SetI ||| |Tsp4CI* | || || MboI TspRI ||| ApaLI | || |DpnI BtsI ||Hpy166II | || BstKTI ||CviRI* | |Hpy188I |MnlI | TspEI BsiYI* BinI* HgiAI* BseSI SduI E R K H L I N T A P H L C T V L P I L I S V N I L S T L P L T C A R C Y Q F * S A * T S Y Q H C P S P V H G A T N S D P ----:----|----:----|----:----|----:----|----:----|----:----| S R L C R I L V A G * R H V T S G I R I R A Y V D * * C Q G E G T C P A V L E S L T F M K D V S G R V Q A R H * W N Q D BsaBI | SfeI* | |BslFI AsuI* | || BspMI AvaII | || |BccI DraII | || || BssKI PpuMI | || || EcoRII |BmgT120I | || || |AlwNI ||SetI CviJI | || || ||ScrFI ||NlaIV | BcgI | || || ||BseBI ||| Csp6I | | ApoI | || || |||SetI ||| |RsaI MslI | | TspEI \ \\ \\ \\\\ \\\ \\ \ \ \ \ CCCATCTACAGCACCTGGCAGGTCCCGTACATCTATATGGGCTGTAAATTCTACGATTTC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GGGTAGATGTCGTGGACCGTCCAGGGCATGTAGATATACCCGACATTTAAGATGCTAAAG / //// / // // // / / / BsaBI |||| | || || || MslI CviJI TspEI |||| | || || |Csp6I BcgI ApoI |||| | || || RsaI |||| | || |PpuMI |||| | || |DraII |||| | || |AvaII |||| | || |AsuI* |||| | || BmgT120I |||| | || NlaIV |||| | |SetI |||| | EcoRII |||| | BssKI |||| BseBI |||| ScrFI |||BspMI ||SetI |AlwNI |BslFI |BccI SfeI* P I Y S T W Q V P Y I Y M G C K F Y D F P S T A P G R S R T S I W A V N S T I S H L Q H L A G P V H L Y G L * I L R F L ----:----|----:----|----:----|----:----|----:----|----:----| G M * L V Q C T G Y M * I P Q L N * S K G W R C C R A P G T C R Y P S Y I R R N G D V A G P L D R V D I H A T F E V I E SecI* Cfr10I SetI DsaI* |HpaII |EciI |Hin4II* || NlaIV BcgI || Tsp4CI* AciI |Tsp4CI* \\ \ \ \\ \ \ \\ TTTGCCGGTTCCCAAAACTTGAAAAAATCATACCTACTGTCCAAATCCGCCACCGTGGAG 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| AAACGGCCAAGGGTTTTGAACTTTTTTAGTATGGATGACAGGTTTAGGCGGTGGCACCTC /// / / / / / / / ||NlaIV BcgI | | Tsp4CI* | | DsaI* |Cfr10I | EciI | | SecI* HpaII SetI | Tsp4CI* | Hin4II* AciI F A G S Q N L K K S Y L L S K S A T V E L P V P K T * K N H T Y C P N P P P W R C R F P K L E K I I P T V Q I R H R G E ----:----|----:----|----:----|----:----|----:----|----:----| K A P E W F K F F D Y R S D L D A V T S R Q R N G F S S F I M G V T W I R W R P K G T G L V Q F F * V * Q G F G G G H L MnlI Csp6I Hpy166II |BccI |RsaI || FatI || |CviAII || || NlaIII TspEI || || | AsuI* CviJI | MseI || || | AvaII |NlaIV | |AhaIII* || || | DraII || FatI | || StuI || || | PpuMI || |CviAII | || CviJI || || | |NlaIV || || NlaIII | || HaeIII || || | |BmgT120I \\ \\ \ \ \\ \ \\ \\ \ \\ AAGGCTCCCATGCTTACCACAGACAATTTAAAGGCCTCGCTTGTGTACCATGATGGGTCC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCGAGGGTACGAATGGTGTCTGTTAAATTTCCGGAGCGAACACATGGTACTACCCAGG // / // /// / ///// // /// || | |FatI ||| HaeIII ||||| |FatI ||PpuMI || | CviAII ||| CviJI ||||| | ||DraII || NlaIII ||| StuI ||||| | ||AvaII |NlaIV ||MseI ||||| | ||AsuI* CviJI |AhaIII* ||||| | |BmgT120I TspEI ||||| | NlaIV ||||| CviAII ||||NlaIII |||Csp6I |||BccI ||RsaI |Hpy166II MnlI K A P M L T T D N L K A S L V Y H D G S R L P C L P Q T I * R P R L C T M M G P G S H A Y H R Q F K G L A C V P * W V L ----:----|----:----|----:----|----:----|----:----|----:----| F A G M S V V S L K F A E S T Y W S P D S P E W A * W L C N L P R A Q T G H H T L S G H K G C V I * L G R K H V M I P G BglI MwoI | XcmI Hin6I | |OliI BceAI | |MslI |GlaI MlyI | |BccI ||HhaI PleI HinfI MwoI | |CviJI |||HaeII |MseI | FnuDII* | CviJI | || TsoI |||| Tsp4CI* \\ \ \ \ \ \ \\ \ \\\\ \ TTTAACGACTCGCGTTTGAACGCCACTTTAGCCATCACGGCTGTGGAGAACGGCGCTACC 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| AAATTGCTGAGCGCAAACTTGCGGTGAAATCGGTAGTGCCGACACCTCTTGCCGCGATGG // / / / / / / / // / //// / || MseI | FnuDII* MwoI | | | || TsoI |||| Tsp4CI* |PleI HinfI | | | |BccI |||BceAI MlyI | | | CviJI |||Hin6I | | | MslI ||GlaI | | | OliI |HhaI | | XcmI HaeII | MwoI | BglI CviJI F N D S R L N A T L A I T A V E N G A T L T T R V * T P L * P S R L W R T A L P * R L A F E R H F S H H G C G E R R Y R ----:----|----:----|----:----|----:----|----:----|----:----| K L S E R K F A V K A M V A T S F P A V R * R S A N S R W K L W * P Q P S R R * K V V R T Q V G S * G D R S H L V A S G TspEI | MboI Hpy178III* Csp6I | BclI | BceAI |RsaI | | DpnI PflMI SetI | | MnlI TaqI |SetI | | |BstKTI BsiYI* | MnlI \ \ \ \ \\ \ \ \\ \ \ \ GTCTTGAACTATGTCGAGGTACAAAAATTGATCAAAGACCCAACTTCTGGTAAGGTTATC 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CAGAACTTGATACAGCTCCATGTTTTTAACTAGTTTCTGGGTTGAAGACCATTCCAATAG / / / // /// / / / / | BceAI | |Csp6I ||| BclI BsiYI* SetI MnlI | MnlI | RsaI ||| MboI PflMI Hpy178III* TaqI ||DpnI SetI |BstKTI TspEI V L N Y V E V Q K L I K D P T S G K V I S * T M S R Y K N * S K T Q L L V R L S L E L C R G T K I D Q R P N F W * G Y R ----:----|----:----|----:----|----:----|----:----|----:----| T K F * T S T C F N I L S G V E P L T I R R S S H R P V F I S * L G L K Q Y P * D Q V I D L Y L F Q D F V W S R T L N D HgiCI* | NlaIV | | SecI* | | | AsuI* | | | |BssKI | | | |CviJI | | | |HaeIII | | | |BmgT120I | | | ||AvaI | | | ||BssKI | | | ||SecI* | | | ||Cfr9I | | | ||BsiYI* | | | |||HpaII | | | |||ScrFI | | | |||CauII* | | | |||BmeT110I | | | ||||SmaI | | | ||||ScrFI | | | ||||CauII* BslFI | | | ||||| BsmAI | NmeAIII | | | ||||| |MaeII | | AluI Hpy188I | | | ||||| || SetI | | CviJI |TfiI | | | ||||| || TaiI | | | SetI |HinfI \ \ \ \\\\\ \\ \ \ \ \ \ \\ GGTGCCGAGGCCCGGGACGTTGAGACTAATGAGCTTGTCAGAATCAACGCTAAATGTGTG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CCACGGCTCCGGGCCCTGCAACTCTGATTACTCGAACAGTCTTAGTTGCGATTTACACAC / / ///////// // / /// / / | | ||||||||| |BsmAI | ||CviJI | HinfI | | ||||||||| MaeII | ||AluI | TfiI | | ||||||||BssKI | |BslFI Hpy188I | | ||||||||TaiI | SetI | | ||||||||SetI NmeAIII | | |||||||Cfr9I | | |||||||BssKI | | |||||||SecI* | | |||||||AvaI | | ||||||BmeT110I | | ||||||CauII* | | ||||||HpaII | | ||||||ScrFI | | |||||CauII* | | |||||ScrFI | | |||||SmaI | | ||||AsuI* | | |||BmgT120I | | ||HaeIII | | ||CviJI | | |SecI* | | BsiYI* | HgiCI* NlaIV G A E A R D V E T N E L V R I N A K C V V P R P G T L R L M S L S E S T L N V W C R G P G R * D * * A C Q N Q R * M C G ----:----|----:----|----:----|----:----|----:----|----:----| P A S A R S T S V L S S T L I L A L H T R H R P G P R Q S * H A Q * F * R * I H T G L G P V N L S I L K D S D V S F T H SecI* DsaI* | AsuI* | Bsp120I | |AsuI* | |BmgT120I | ||CviJI | ||NlaIV | ||HaeIII | ||BmgT120I | ||| ApaI | ||| SduI HgaI | ||| BseSI | XcmI | ||| HgiJII* | CviRI* | ||| | MaeIII | | FokI | ||| | Tsp45I | | | AsuI* BseGI | ||| | Tsp4CI* | | | AvaII | BetI* | ||| | | AcyI | | | |BmgT120I | |HpaII | ||| | | |TspRI | | | || AciI | || BccI \ \\\ \ \ \\ \ \ \ \\ \ \ \\ \ GTCAATGCCACGGGCCCATACAGTGACGCCATTTTGCAAATGGACCGCAACCCATCCGGT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTTACGGTGCCCGGGTATGTCACTGCGGTAAAACGTTTACCTGGCGTTGGGTAGGCCA / /// / / // // / /// / / // | ||| | | |AcyI || | ||| | BseGI |BetI* | ||| | | Tsp45I || | ||| AciI HpaII | ||| | | MaeIII || | ||AvaII | ||| | Tsp4CI* || | ||AsuI* | ||| TspRI || | |BmgT120I | ||Bsp120I || | FokI | ||AsuI* || HgaI | |BmgT120I |CviRI* | |AsuI* XcmI | BmgT120I | HaeIII | NlaIV | CviJI HgiJII* DsaI* SecI* BseSI SduI ApaI V N A T G P Y S D A I L Q M D R N P S G S M P R A H T V T P F C K W T A T H P V Q C H G P I Q * R H F A N G P Q P I R S ----:----|----:----|----:----|----:----|----:----|----:----| T L A V P G Y L S A M K C I S R L G D P P * H W P G M C H R W K A F P G C G M R D I G R A W V T V G N Q L H V A V W G T MboI |Hin4I |Hin4I ||DpnI |||BstKTI |||| SalI MlyI |||| |TaqI PleI |||| |AccI | HpaII |||| |BsaXI | | HinfI |||| ||HindII | | | BsaXI |||| ||Hpy166II | | | | AciI FauI |||| ||| BceAI \ \ \ \ \ \ \\\\ \\\ \ CTGCCGGACTCCCCGCTAAACGACAACTCCAAGATCAAGTCGACTTTCAATCAAATCGCC 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| GACGGCCTGAGGGGCGATTTGCTGTTGAGGTTCTAGTTCAGCTGAAAGTTAGTTTAGCGG // // / / / / // // /// / / || || | AciI FauI | || || ||| BceAI Hin4I || || HinfI | || || ||SalI Hin4I || |BsaXI | || || |AccI || HpaII | || || |TaqI |PleI | || || Hpy166II BccI | || || HindII MlyI | || |BsaXI | || MboI | |DpnI | BstKTI Hin4I Hin4I L P D S P L N D N S K I K S T F N Q I A C R T P R * T T T P R S S R L S I K S P A G L P A K R Q L Q D Q V D F Q S N R R ----:----|----:----|----:----|----:----|----:----|----:----| R G S E G S F S L E L I L D V K L * I A D A P S G A L R C S W S * T S K * D F R Q R V G R * V V V G L D L R S E I L D G FatI |CviAII || Hin4I || Hin4I || |AsuI* || |AvaII || |NlaIII || ||FokI || ||BmgT120I PflMI || ||| BsiYI* BsiYI* || |||NlaIV | BseGI | BccI Hpy166II \\ \\\\ \ \ \ \ \ GTCATGGACCCGAAAATGGTCATCCCATCTATTGGCGTTCACATCGTATTGCCCTCTTTT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTACCTGGGCTTTTACCAGTAGGGTAGATAACCGCAAGTGTAGCATAACGGGAGAAAA / // // // / / / / | || || || BseGI | BccI Hpy166II | || || |BsiYI* BsiYI* | || || FokI PflMI | || |AvaII | || |AsuI* | || BmgT120I | || NlaIV | |FatI | CviAII NlaIII V M D P K M V I P S I G V H I V L P S F S W T R K W S S H L L A F T S Y C P L F H G P E N G H P I Y W R S H R I A L F L ----:----|----:----|----:----|----:----|----:----|----:----| T M S G F I T M G D I P T * M T N G E K R * P G S F P * G M * Q R E C R I A R K D H V R F H D D W R N A N V D Y Q G R K AcyI MaeII |ZraI || SetI || TaiI || AatII || | Hpy188I || | | BccI MnlI || | | | SetI Hin4II* || | | | | Hpy188I | MmeI || | | | | | MnlI \ \ \\ \ \ \ \ \ \ TACTGCCCGAAGGATATGGGTTTGTTGGACGTCAGAACCTCTGATGGCAGAGTGATGTTC 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| ATGACGGGCTTCCTATACCCAAACAACCTGCAGTCTTGGAGACTACCGTCTCACTACAAG // / // / / / / / |MmeI | || | | | | MnlI Hin4II* | || | | | Hpy188I MnlI | || | | BccI | || | SetI | || Hpy188I | |MaeII | |AcyI | ZraI AatII TaiI SetI Y C P K D M G L L D V R T S D G R V M F T A R R I W V C W T S E P L M A E * C S L P E G Y G F V G R Q N L * W Q S D V L ----:----|----:----|----:----|----:----|----:----|----:----| * Q G F S I P K N S T L V E S P L T I N K S G S P Y P N T P R * F R Q H C L S T V A R L I H T Q Q V D S G R I A S H H E FokI MroNI Cfr10I |HpaII StyI ||NaeI SecI* ||Cac8I | SetI |||HgiCI* BseGI | | BsiYI* |||| NlaIV | BslFI \ \ \ \\\\ \ \ \ TTTTTACCTTGGCAGGGCAAAGTCCTTGCCGGCACCACAGACATCCCACTAAAGCAAGTC 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| AAAAATGGAACCGTCCCGTTTCAGGAACGGCCGTGGTGTCTGTAGGGTGATTTCGTTCAG / // //// / / / SetI |SecI* |||| | BseGI BslFI |StyI |||| HgiCI* BsiYI* |||NlaIV ||Cfr10I ||MroNI ||FokI |HpaII Cac8I NaeI F L P W Q G K V L A G T T D I P L K Q V F Y L G R A K S L P A P Q T S H * S K S F T L A G Q S P C R H H R H P T K A S P ----:----|----:----|----:----|----:----|----:----|----:----| K K G Q C P L T R A P V V S M G S F C T R K V K A P C L G Q R C W L C G V L A L K * R P L A F D K G A G C V D W * L L D Hpy178III* | EcoRV MnlI CviJI | | Hpy178III* | SfeI* AlwNI | | | SfeI* \ \ \ \ \ \ \ CCAGAAAACCCTATGCCTACAGAGGCTGATATTCAAGATATCTTGAAAGAACTACAGCAC 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCTTTTGGGATACGGATGTCTCCGACTATAAGTTCTATAGAACTTTCTTGATGTCGTG / // / / / / / MnlI || CviJI | | Hpy178III* SfeI* |AlwNI | EcoRV SfeI* Hpy178III* P E N P M P T E A D I Q D I L K E L Q H Q K T L C L Q R L I F K I S * K N Y S T R K P Y A Y R G * Y S R Y L E R T T A L ----:----|----:----|----:----|----:----|----:----|----:----| G S F G I G V S A S I * S I K F S S C C G L F G * A * L P Q Y E L Y R S L V V A W F V R H R C L S I N L I D Q F F * L V MaeII |BtrI || SetI || TaiI || BbvII* || | DdeI || | | MboII || | | | FatI || | | | CviRI* || | | | |CviAII TaqI || | | | || NlaIII | ApoI || | | | || | CviJI | TspEI || | | | || | |Hin4I Hpy188I | EcoRI || | | | || | |Hin4I | SetI \ \ \\ \ \ \ \\ \ \\ \ \ TATATCGAATTCCCCGTGAAAAGAGAAGACGTGCTAAGTGCATGGGCTGGTGTCAGACCT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| ATATAGCTTAAGGGGCACTTTTCTCTTCTGCACGATTCACGTACCCGACCACAGTCTGGA / / / // // / /// / / / / | EcoRI | || || | ||| CviJI | | Eam1105I | TspEI | || || | ||FatI | | TstI | ApoI | || || | |CviAII | SetI TaqI | || || | Hin4I Hpy188I | || || | Hin4I | || || CviRI* | || || NlaIII | || |DdeI | || BbvII* | || MboII | |MaeII | BtrI TaiI SetI Y I E F P V K R E D V L S A W A G V R P I S N S P * K E K T C * V H G L V S D L Y R I P R E K R R R A K C M G W C Q T F ----:----|----:----|----:----|----:----|----:----|----:----| * I S N G T F L S S T S L A H A P T L G S Y R I G R S F L L R A L H M P Q H * V I D F E G H F S F V H * T C P S T D S R Eam1105I | BinI* | |TstI | || Hpy188I | || | MboI | || | XhoII | || | | DpnI | || | | |BstKTI | || | | || MaeII | || | | || |BsaAI | || | | || ||Csp6I CviJI | || | | || |||RsaI BsiYI* | SduI | || | | || |||SetI |BsiYI* | HgiJII* | || | | || |||TaiI ||FauI | | MboII | || | | || ||||Hin4I ||Hin4II* | | | DdeI | || | | || ||||Hin4I AciI ||| TstI | | | | XcmI \ \\ \ \ \\ \\\\\ \ \\\ \ \ \ \ \ \ TTGGTCAGAGATCCACGTACAATCCCCGCAGACGGGAAGAAGGGCTCTGCCACTCAGGGC 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| AACCAGTCTCTAGGTGCATGTTAGGGGCGTCTGCCCTTCTTCCCGAGACGGTGAGTCCCG // // // //// // / / / / / / || || || |||Csp6I || | FauI | | MboII XcmI || || || ||RsaI || Hin4II* | CviJI DdeI || || || |MaeII || TstI HgiJII* || || || BsaAI |BsiYI* SduI || || |Hin4I BsiYI* || || |Hin4I AciI || || |TaiI || || |SetI || || XhoII || || MboI || |DpnI || BstKTI |Hpy188I BinI* L V R D P R T I P A D G K K G S A T Q G W S E I H V Q S P Q T G R R A L P L R A G Q R S T Y N P R R R E E G L C H S G R ----:----|----:----|----:----|----:----|----:----|----:----| K T L S G R V I G A S P F F P E A V * P K P * L D V Y L G R L R S S P S Q W E P Q D S I W T C D G C V P L L A R G S L A BinI* | BspCNI | |MboI CviJI | |XhoII HaeIII | |BseMII | TspEI | || DpnI Hpy166II | | AarI CviRI* | || |BstKTI | Hpy188I | | BspMI | SetI \ \\ \\ \ \ \ \ \ \ \ GTGGTAAGATCCCACTTCTTGTTCACTTCGGATAATGGCCTAATTACTATTGCAGGTGGT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CACCATTCTAGGGTGAAGAACAAGTGAAGCCTATTACCGGATTAATGATAACGTCCACCA /// // / / / / / / // ||| || XhoII | Hpy188I HaeIII | | |SetI ||| || MboI Hpy166II CviJI | | CviRI* ||| |DpnI | BspMI ||| BstKTI | AarI ||BseMII TspEI |BspCNI BinI* V V R S H F L F T S D N G L I T I A G G W * D P T S C S L R I M A * L L L Q V V G K I P L L V H F G * W P N Y Y C R W * ----:----|----:----|----:----|----:----|----:----|----:----| T T L D W K K N V E S L P R I V I A P P R P L I G S R T * K P Y H G L * * Q L H H Y S G V E Q E S R I I A * N S N C T T Tsp4CI* BseMII |SalI |BspCNI ||TaqI || MnlI ||AccI || | CviJI |||HindII || | |DdeI |||Hpy166II || | |BbvCI |||| DrdI || | |Bpu10I |||| | TaqI AciI \\ \ \\ \\\\ \ \ \ AAATGGACTACTTACAGACAAATGGCTGAGGAAACAGTCGACAAAGTTGTCGAAGTTGGC 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TTTACCTGATGAATGTCTGTTTACCGACTCCTTTGTCAGCTGTTTCAACAGCTTCAACCG // / / / / /// / / || MnlI | | | ||| DrdI TaqI |BspCNI | | | ||SalI BseMII | | | |AccI | | | |TaqI | | | Hpy166II | | | HindII | | Tsp4CI* | Bpu10I | BbvCI | DdeI CviJI K W T T Y R Q M A E E T V D K V V E V G N G L L T D K W L R K Q S T K L S K L A M D Y L Q T N G * G N S R Q S C R S W R ----:----|----:----|----:----|----:----|----:----|----:----| L H V V * L C I A S S V T S L T T S T P Y I S * K C V F P Q P F L R C L Q R L Q F P S S V S L H S L F C D V F N D F N A MseI | HindIII | | AluI SetI | | CviJI TfiI SetI |MaeIII | | | SetI HinfI EciI |Tsp45I | | | Cac8I CviRI* \ \ \\ \ \ \ \ \ GGATTCCACAACCTGAAACCTTGTCACACAAGAGATATTAAGCTTGCTGGTGCAGAAGAA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CCTAAGGTGTTGGACTTTGGAACAGTGTGTTCTCTATAATTCGAACGACCACGTCTTCTT / / / / / / / / / / | | | EciI SetI Tsp45I | | HindIII CviRI* | | SetI MaeIII | | Cac8I | HinfI | CviJI | TfiI | AluI AciI MseI SetI G F H N L K P C H T R D I K L A G A E E D S T T * N L V T Q E I L S L L V Q K N I P Q P E T L S H K R Y * A C W C R R M ----:----|----:----|----:----|----:----|----:----|----:----| P N W L R F G Q * V L S I L S A P A S S R I G C G S V K D C L L Y * A Q Q H L L S E V V Q F R T V C S I N L K S T C F F MboII | BsgI MwoI | |HgaI CviJI | CviJI \ \\ \ \ \ TGGACGCAAAACTATGTGGCTTTATTGGCTCAAAACTACCATTTATCATCAAAAATGTCC 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| ACCTGCGTTTTGATACACCGAAATAACCGAGTTTTGATGGTAAATAGTAGTTTTTACAGG / / / / / / | BsgI | | MwoI CviJI MboII | CviJI HgaI W T Q N Y V A L L A Q N Y H L S S K M S G R K T M W L Y W L K T T I Y H Q K C P D A K L C G F I G S K L P F I I K N V Q ----:----|----:----|----:----|----:----|----:----|----:----| H V C F * T A K N A * F * W K D D F I D I S A F S H P K I P E F S G N I M L F T P R L V I H S * Q S L V V M * * * F H G MmeI MnlI |NlaIV | ApoI TfiI BstXI || XmnI TspGWI | TspEI HinfI \ \\ \ \ \ \ \ AACTACTTGGTTCAAAACTACGGAACCCGTTCCTCTATCATTTGCGAATTTTTCAAAGAA 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TTGATGAACCAAGTTTTGATGCCTTGGGCAAGGAGATAGTAAACGCTTAAAAAGTTTCTT / / / / / / / BstXI | | XmnI TspGWI MnlI TspEI | NlaIV ApoI MmeI N Y L V Q N Y G T R S S I I C E F F K E T T W F K T T E P V P L S F A N F S K N L L G S K L R N P F L Y H L R I F Q R I ----:----|----:----|----:----|----:----|----:----|----:----| L * K T * F * P V R E E I M Q S N K L S W S S P E F S R F G N R * * K R I K * L V V Q N L V V S G T G R D N A F K E F F FatI NcoI StyI SecI* DsaI* DdeI MaeII |CviAII Bpu10I | SetI MnlI || NlaIII | CviJI | TaiI | MaeI \\ \ \ \ \ \ \ \ TCCATGGAAAATAAACTGCCTTTGTCCTTAGCCGACAAGGAAAATAACGTAATCTACTCT 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTACCTTTTATTTGACGGAAACAGGAATCGGCTGTTCCTTTTATTGCATTAGATGAGA // // // / / / || |DsaI* |CviJI | MaeII MnlI || |SecI* Bpu10I TaiI || |StyI DdeI SetI || |NcoI || |FatI || CviAII |NlaIII HinfI TfiI S M E N K L P L S L A D K E N N V I Y S P W K I N C L C P * P T R K I T * S T L H G K * T A F V L S R Q G K * R N L L * ----:----|----:----|----:----|----:----|----:----|----:----| D M S F L S G K D K A S L S F L T I * E I W P F Y V A K T R L R C P F Y R L R S G H F I F Q R Q G * G V L F I V Y D V R BseRI Hpy188I | TspEI | EcoRV \ \ \ \ AGCGAGGAGAACAACTTGGTCAATTTTGATACTTTCAGATATCCATTCACAATCGGTGAG 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| TCGCTCCTCTTGTTGAACCAGTTAAAACTATGAAAGTCTATAGGTAAGTGTTAGCCACTC / / / / / MaeI BseRI TspEI | EcoRV Hpy188I S E E N N L V N F D T F R Y P F T I G E A R R T T W S I L I L S D I H S Q S V S R G E Q L G Q F * Y F Q I S I H N R * V ----:----|----:----|----:----|----:----|----:----|----:----| L S S F L K T L K S V K L Y G N V I P S * R P S C S P * N Q Y K * I D M * L R H A L L V V Q D I K I S E S I W E C D T L HphI | FatI | |CviAII | || CviRI* | || NlaIII | || | Csp6I StyI MseI | || | |RsaI SspI SecI* MseI \ \ \\ \ \\ \ \ \ TTAAAGTATTCCATGCAGTACGAATATTGTAGAACTCCCTTGGACTTCCTTTTAAGAAGA 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| AATTTCATAAGGTACGTCATGCTTATAACATCTTGAGGGAACCTGAAGGAAAATTCTTCT / / / // // / / / | HphI | || || SspI SecI* MseI MseI | || |Csp6I StyI | || RsaI | |CviRI* | |FatI | CviAII NlaIII L K Y S M Q Y E Y C R T P L D F L L R R * S I P C S T N I V E L P W T S F * E E K V F H A V R I L * N S L G L P F K K N ----:----|----:----|----:----|----:----|----:----|----:----| N F Y E M C Y S Y Q L V G K S K R K L L T L T N W A T R I N Y F E R P S G K L F * L I G H L V F I T S S G Q V E K * S S AcyI |Hin4II* BsmI || StyI | FatI || SecI* | CviRI* || | BceAI | |MwoI || | | MwoI | |CviAII || | | HgaI | ||Cac8I || | | |HindIII | ||| SphI || | | || AluI | ||| NspI TfiI || | | || CviJI | ||| NlaIII HinfI || | | || | SetI | ||| | Tsp4CI* | MboII || | | || | | MwoI | ||| | |TaqII \ \ \\ \ \ \\ \ \ \ \ \\\ \ \\ ACAAGATTCGCCTTCTTGGACGCCAAGGAAGCTTTGAATGCCGTGCATGCCACCGTCAAA 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTCTAAGCGGAAGAACCTGCGGTTCCTTCGAAACTTACGGCACGTACGGTGGCAGTTT // / / / / / / // / / / /// / |HinfI | | | | | | |MwoI | | | ||| Tsp4CI* |TfiI | | | | | | | | | | ||| TaqII MboII | | | | | | | | | | ||FatI | | | | | | | | | | |CviAII | | | | | | | | | | Cac8I | | | | | | | | | CviRI* | | | | | | | | | NlaIII | | | | | | | | | NspI | | | | | | | | | SphI | | | | | | | | MwoI | | | | | | | BsmI | | | | | | HindIII | | | | | | HgaI | | | | | CviJI | | | | | AluI | | | | SetI | | | SecI* | | | BceAI | | | StyI | | MwoI | AcyI Hin4II* T R F A F L D A K E A L N A V H A T V K Q D S P S W T P R K L * M P C M P P S K K I R L L G R Q G S F E C R A C H R Q S ----:----|----:----|----:----|----:----|----:----|----:----| V L N A K K S A L S A K F A T C A V T L F L I R R R P R W P L K S H R A H W R * C S E G E Q V G L F S Q I G H M G G D F BtsI MfeI TspRI TspEI Hpy188I | BdaI TspDTI MmeI |HphI | MnlI | BdaI | Tsp4CI* \ \\ \ \ \ \ \ \ GTTATGGGTGATGAGTTCAATTGGTCGGAGAAAAAGAGGCAGTGGGAACTTGAAAAAACT 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| CAATACCCACTACTCAAGTTAACCAGCCTCTTTTTCTCCGTCACCCTTGAACTTTTTTGA / / / / / / / / / / MmeI | | | MnlI TspRI BtsI BdaI | Tsp4CI* | | Hpy188I BdaI TspDTI | TspEI | MfeI HphI V M G D E F N W S E K K R Q W E L E K T L W V M S S I G R R K R G S G N L K K L Y G * * V Q L V G E K E A V G T * K N C ----:----|----:----|----:----|----:----|----:----|----:----| T I P S S N L Q D S F F L C H S S S F V L * P H H T * N T P S F S A T P V Q F F N H T I L E I P R L F L P L P F K F F S Hpy178III* | MaeII | | SetI BdaI Hpy166II | | TaiI BdaI \ \ \ \ \ GTGAACTTCATCAAGACGTTTGGTGTCTAA 1930 1940 1950 ----:----|----:----|----:----| CACTTGAAGTAGTTCTGCAAACCACAGATT / // / / Hpy166II || | BdaI || | BdaI || MaeII |TaiI |SetI Hpy178III* V N F I K T F G V * * T S S R R L V S X E L H Q D V W C L X ----:----|----:----|----:----| T F K M L V N P T * Q S S * * S T Q H R H V E D L R K T D L # Enzymes that cut Frequency Isoschizomers AarI 1 AatII 1 AccI 2 FblI,XmiI AciI 10 BspACI,SsiI AcyI 3 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 1 AhaIII* 1 DraI AluI 6 AluBI AlwNI 3 CaiI ApaI 1 ApaLI 2 Alw44I,VneI ApoI 3 AcsI,XapI AsuI* 10 Cfr13I,PspPI,Sau96I,AspS9I AvaI 3 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 5 Bme18I,Eco47I,SinI,VpaK11BI BalI 2 MlsI,MluNI,MscI,Msp20I BbvCI 1 BbvI 5 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 6 BceAI 5 BcgI 1 BclI 2 FbaI,Ksp22I BdaI 2 BetI* 1 BsaWI BglI 1 BinI* 4 AlwI,BspPI,AclWI BisI 6 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 6 BmeT110I 3 BmgT120I 10 Bpu10I 2 BsaAI 1 BstBAI,Ppu21I BsaBI 1 Bse8I,BseJI BsaXI 2 BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 5 BstF5I,BtsCI BseMII 2 BseRI 1 BseSI 4 BaeGI,BstSLI BsgI 2 BsiYI* 8 Bsc4I,BseLI,BslI,AfiI BslFI 6 BsmFI,FaqI BsmAI 3 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI Bsp120I 1 PspOMI BspCNI 2 BspMI 4 BfuAI,Acc36I,BveI BsrBI 1 AccBSI,MbiI BsrI 2 BseNI,Bse1I,BsrSI BssKI 4 BstSCI,StyD4I BstAPI 1 BstKTI 7 BstXI 1 BtrI 2 BmgBI,AjiI BtsI 2 Cac8I 3 BstC8I CauII* 2 BcnI,BpuMI,NciI,AsuC2I Cfr10I 3 BsrFI,BssAI,Bse118I Cfr9I 1 TspMI,XmaCI,XmaI CfrI 2 AcoI,EaeI Csp6I 7 CviQI,RsaNI CviAII 9 CviJI 29 CviKI-1 CviRI* 10 HpyCH4V DdeI 5 BstDEI,HpyF3I DpnI 7 MalI DraII 2 EcoO109I DrdI 1 AasI,DseDI DsaI* 6 BtgI,BstDSI Eam1105I 1 AspEI,BmeRI,DriI,AhdI EciI 2 Eco31I 2 Bso31I,BspTNI,BsaI EcoP15I 2 EcoRI 1 EcoRII 2 AjnI,Psp6I,PspGI EcoRV 2 Eco32I FatI 9 FauI 3 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 5 GlaI 1 HaeII 1 BstH2I HaeIII 10 BsnI,BsuRI,BshFI,PhoI HgaI 5 CseI HgiAI* 2 Bbv12I,BsiHKAI,Alw21I HgiCI* 2 BanI,BshNI,BspT107I,AccB1I HgiJII* 2 Eco24I,EcoT38I,FriOI,BanII HhaI 1 BstHHI,CfoI,AspLEI Hin4I 5 Hin4II* 6 HpyAV Hin6I 1 HinP1I,HspAI HindII 2 HincII HindIII 2 HinfI 8 HpaII 6 HapII,BsiSI,MspI HphI 4 AsuHPI Hpy166II 9 Hpy8I Hpy178III* 6 Hpy188III Hpy188I 9 Hpy99I 2 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 4 FspBI,BfaI,XspI MaeII 8 HpyCH4IV MaeIII 3 MboI 7 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 6 MfeI 1 MunI MlyI 3 SchI MmeI 3 MnlI 13 MroNI 1 NgoMIV MseI 5 Tru1I,Tru9I MslI 2 RseI,SmiMI MwoI 12 HpyF10VI,BstMWI NaeI 1 PdiI NcoI 2 Bsp19I NlaIII 9 Hin1II,Hsp92II,FaeI NlaIV 10 BspLI,BmiI,PspN4I NmeAIII 1 NspBII* 1 MspA1I NspI 1 BstNSI,XceI OliI 1 AleI PflMI 2 BasI,AccB7I,Van91I PleI 3 PpsI PpuMI 2 Psp5II,PspPPI PvuII 1 RsaI 7 AfaI SalI 2 SapI 1 LguI,PciSI,BspQI ScrFI 4 BmrFI,MspR9I,Bme1390I SduI 5 MhlI,Bsp1286I SecI* 15 BseDI,BssECI,BsaJI SetI 29 SfaNI 2 LweI SfeI* 3 BstSFI,SfcI,BfmI SmaI 1 SphI 1 PaeI,BbuI SspI 1 StuI 2 Eco147I,PceI,SseBI,AatI StyI 7 Eco130I,EcoT14I,ErhI,BssT1I TaiI 8 TaqI 7 TaqII 1 TatI 1 TauI 1 TfiI 5 PfeI TseI 5 ApeKI TsoI 2 Tsp45I 2 NmuCI Tsp4CI* 10 HpyCH4III,TaaI,Bst4CI TspDTI 1 TspEI 11 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 3 TscAI TstI 4 XbaI 1 XcmI 4 XhoII 3 BstYI,MflI,PsuI,BstX2I XmnI 2 MroXI,PdmI,Asp700I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AbsI Acc65I AclI AflII AgeI AjuI AlfI AloI AscI Asp718I AsuII AvrII BaeI BamHI BarI Bce83I* BciVI BfiI BglII BmtI BplI BsePI BseYI BsiI* Bsp1407I BspHI BspLU11I* BspMII* BspOI BsrDI BssNAI Bst1107I BstEII BstZ17I BtgZI ClaI CspCI DinI DraIII Ecl136II Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoT22I EgeI EheI Esp3I EspI* FalI FseI FspAI GsaI GsuI HpaI KasI KpnI MauBI McrI* MluI Mph1103I MstI* NarI NdeI NheI NotI NruI NsiI PacI PasI PfoI PmaCI PmeI PpiI PshAI PsiI PspXI PsrI PstI PvuI RsrII SacI SacII SanDI SauI* ScaI SexAI SfiI SfoI SgfI SgrAI SgrDI SmlI SnaBI SpeI SplI* SrfI Sse232I* Sse8387I SwaI Tth111I VspI XhoI XmaIII* Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769