Restriction Map of STE12/YHR084W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

STE12/YHR084W on chromosome VIII from coordinates 274174 to 276240.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2458

AluI CviJI TspDTI MnlI TsoI MseI | SetI \ \ \ \ \ \ ATGAAAGTCCAAATAACCAATAGTAGAACAGAGGAAATCTTAAAAGTTCAAGCTAATAAT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTTCAGGTTTATTGGTTATCATCTTGTCTCCTTTAGAATTTTCAAGTTCGATTATTA / / / / / / TspDTI MnlI TsoI MseI | CviJI | AluI SetI M K V Q I T N S R T E E I L K V Q A N N * K S K * P I V E Q R K S * K F K L I M E S P N N Q * * N R G N L K S S S * * * ----:----|----:----|----:----|----:----|----:----|----:----| X F T W I V L L L V S S I K F T * A L L X S L G F L W Y Y F L P F R L L E L * Y H F D L Y G I T S C L F D * F N L S I I AluI CviJI |TspDTI ||SetI DdeI ||| BssKI Bpu10I ||| |HpaII | MboII ||| ||ScrFI TfiI | | MseI TspDTI ||| ||CauII* HinfI | | SetI \ \\\ \\\ \ \ \ \ GAAAACGATGAAGTCAGTAAAGCTACTCCGGGCGAAGTTGAAGAATCGCTAAGGTTAATC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTGCTACTTCAGTCATTTCGATGAGGCCCGCTTCAACTTCTTAGCGATTCCAATTAG / /// / / / // / TspDTI ||CviJI | BssKI | || MseI ||AluI CauII* | |Bpu10I |TspDTI HpaII | |DdeI SetI ScrFI | MboII | SetI HinfI TfiI E N D E V S K A T P G E V E E S L R L I K T M K S V K L L R A K L K N R * G * S K R * S Q * S Y S G R S * R I A K V N R ----:----|----:----|----:----|----:----|----:----|----:----| S F S S T L L A V G P S T S S D S L N I H F R H L * Y L * E P R L Q L I A L T L F V I F D T F S S R A F N F F R * P * D Hin6I |GlaI ||HhaI MboI ||Cfr10I | DpnI |||HpaII | |BstKTI |||HaeII | || ApoI |||| TsoI TspEI | || TspEI CviJI |||| TspEI | PsiI \ \\ \ \ \\\\ \ \ \ GGCGATCTAAAATTCTTTTTAGCCACAGCGCCGGTAAATTGGCAAGAAAACCAAATTATA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CCGCTAGATTTTAAGAAAAATCGGTGTCGCGGCCATTTAACCGTTCTTTTGGTTTAATAT // / / / //// // / // || MboI TspEI | |||| || TspEI |PsiI |DpnI ApoI | |||| |Cfr10I TspEI BstKTI | |||| |TsoI | |||| HpaII | |||Hin6I | ||GlaI | |HhaI | HaeII CviJI G D L K F F L A T A P V N W Q E N Q I I A I * N S F * P Q R R * I G K K T K L * R S K I L F S H S A G K L A R K P N Y K ----:----|----:----|----:----|----:----|----:----|----:----| P S R F N K K A V A G T F Q C S F W I I R R D L I R K L W L A P L N A L F G F * A I * F E K * G C R R Y I P L F V L N Y Hpy166II BsmAI Hpy188I | CviJI | PsrI \ \ \ \ \ AGGCGATACTATCTGAATAGTGGACAAGGCTTTGTCTCTTGTGTATTTTGGAACAATCTA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TCCGCTATGATAGACTTATCACCTGTTCCGAAACAGAGAACACATAAAACCTTGTTAGAT / / / / / Hpy188I | CviJI PsrI BsmAI Hpy166II R R Y Y L N S G Q G F V S C V F W N N L G D T I * I V D K A L S L V Y F G T I Y A I L S E * W T R L C L L C I L E Q S I ----:----|----:----|----:----|----:----|----:----|----:----| L R Y * R F L P C P K T E Q T N Q F L R L A I S D S Y H V L S Q R K H I K S C D P S V I Q I T S L A K D R T Y K P V I * Csp6I |RsaI |SetI CviRI* |PsrI | BsmI ||AlwNI | | PpiI \\\ \ \ \ TACTATATTACAGGTACTGATATTGTCAAATGTTGTCTTTACAGAATGCAAAAGTTTGGG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| ATGATATAATGTCCATGACTATAACAGTTTACAACAGAAATGTCTTACGTTTTCAAACCC // / // / || | |Csp6I CviRI* || | RsaI BsmI || AlwNI PpiI |SetI PsrI Y Y I T G T D I V K C C L Y R M Q K F G T I L Q V L I L S N V V F T E C K S L G L Y Y R Y * Y C Q M L S L Q N A K V W E ----:----|----:----|----:----|----:----|----:----|----:----| Y * I V P V S I T L H Q R * L I C F N P I S Y * L Y Q Y Q * I N D K C F A F T Q V I N C T S I N D F T T K V S H L L K P ApoI TspEI |Ksp632I* MboII ||MnlI | Hpy188I XmnI |||PpiI | | MseI \ \\\\ \ \ \ AGAGAAGTAGTTCAAAAGAAAAAATTTGAAGAGGGTATTTTTTCAGATTTAAGAAATCTC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCTTCATCAAGTTTTCTTTTTTAAACTTCTCCCATAAAAAAGTCTAAATTCTTTAGAG / / / / / / / XmnI | | Ksp632I* | | MseI | | TspEI | Hpy188I | | ApoI MboII | MnlI PpiI R E V V Q K K K F E E G I F S D L R N L E K * F K R K N L K R V F F Q I * E I S R S S S K E K I * R G Y F F R F K K S Q ----:----|----:----|----:----|----:----|----:----|----:----| L S T T * F F F N S S P I K E S K L F R S L L L E F S F I Q L P Y K K L N L F D S F Y N L L F F K F L T N K * I * S I E Hpy188I |ApoI SfaNI CviRI* |TspEI \ \ \\ AAATGTGGTATAGATGCAACTTTAGAACAACCAAAGTCCGAATTTTTGTCGTTTCTATTC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TTTACACCATATCTACGTTGAAATCTTGTTGGTTTCAGGCTTAAAAACAGCAAAGATAAG / / / / / SfaNI CviRI* | TspEI Hpy188I | ApoI Hpy188I K C G I D A T L E Q P K S E F L S F L F N V V * M Q L * N N Q S P N F C R F Y S M W Y R C N F R T T K V R I F V V S I Q ----:----|----:----|----:----|----:----|----:----|----:----| L H P I S A V K S C G F D S N K D N R N * I H Y L H L K L V V L T R I K T T E I F T T Y I C S * F L W L G F K Q R K * E TspRI Hpy188I Hpy188I | FatI \ \ \ \ AGAAATATGTGTCTGAAAACCCAAAAAAAGCAGAAAGTATTTTTTTGGTTCAGTGTAGCA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTTATACACAGACTTTTGGGTTTTTTTCGTCTTTCATAAAAAAACCAAGTCACATCGT / / / Hpy188I TspRI NlaIII R N M C L K T Q K K Q K V F F W F S V A E I C V * K P K K S R K Y F F G S V * H K Y V S E N P K K A E S I F L V Q C S T ----:----|----:----|----:----|----:----|----:----|----:----| L F I H R F V W F F C F T N K Q N L T A * F Y T D S F G F F A S L I K K T * H L S I H T Q F G L F L L F Y K K P E T Y C CviAII | NlaIII | |MmeI MseI TfiI | || SfaNI AciI BseGI FokI |AhaIII* HinfI CviJI \ \\ \ \ \ \ \\ \ \ CATGATAAGTTGTTTGCGGATGCGTTGGAAAGAGATTTAAAAAGAGAAAGTTTGAATCAG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GTACTATTCAACAAACGCCTACGCAACCTTTCTCTAAATTTTTCTCTTTCAAACTTAGTC // / / / / // / / |FatI | | BseGI | |MseI | CviJI CviAII | AciI | AhaIII* HinfI MmeI SfaNI FokI TfiI H D K L F A D A L E R D L K R E S L N Q M I S C L R M R W K E I * K E K V * I S * * V V C G C V G K R F K K R K F E S A ----:----|----:----|----:----|----:----|----:----|----:----| C S L N N A S A N S L S K F L S L K F * V H Y T T Q P H T P F L N L F L F N S D M I L Q K R I R Q F S I * F S F T Q I L CviJI | AciI | SduI | Cac8I | HgiJII* | | TspDTI | | | FauI | | | | Hin4I DdeI | | | | Hin4I Hin4II* | | | | | NdeI | CviJI | | | | | | TfiI | | MseI | | | | | | HinfI Hpy188I \ \ \ \ \ \ \ \ \ \ \ CCTTCAACGACTAAGCCCGTTAATGAGCCCGCCTTATCTTTTTCATATGATTCCTCATCT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GGAAGTTGCTGATTCGGGCAATTACTCGGGCGGAATAGAAAAAGTATACTAAGGAGTAGA / // / / / /// / / / / / | |CviJI | | | ||| | FauI NdeI HinfI Hpy188I | DdeI | | | ||| Hin4I TfiI Hin4II* | | | ||| Hin4I | | | ||AciI | | | |TspDTI | | | Cac8I | | CviJI | HgiJII* | SduI MseI P S T T K P V N E P A L S F S Y D S S S L Q R L S P L M S P P Y L F H M I P H L F N D * A R * * A R L I F F I * F L I * ----:----|----:----|----:----|----:----|----:----|----:----| G E V V L G T L S G A K D K E Y S E E D A K L S * A R * H A R R I K K M H N R M R * R S L G N I L G G * R K * I I G * R TfiI HinfI | XbaI | |MaeI | |Hpy178III* Hin4I | || BbvII* Hin4I | || | MaeI | MboI | || | | TatI | | DpnI | || | | |Csp6I | | MnlI | || | | |MboII MnlI | | |BstKTI | || | | ||RsaI | CviJI | | || MaeIII | || | | ||BccI \ \ \ \ \\ \ \ \\ \ \ \\\ GATAAGCCTCTCTACGATCAGTTACTTCAACATTTAGATTCTAGAAGACCATCTAGTACA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CTATTCGGAGAGATGCTAGTCAATGAAGTTGTAAATCTAAGATCTTCTGGTAGATCATGT / // // / / / // / /// | |Hin4I || MboI MaeIII | |XbaI | ||TatI | |Hin4I |DpnI | Hpy178III* | |Csp6I | CviJI BstKTI | MaeI | |BccI MnlI MnlI HinfI | RsaI TfiI BbvII* MboII MaeI D K P L Y D Q L L Q H L D S R R P S S T I S L S T I S Y F N I * I L E D H L V Q * A S L R S V T S T F R F * K T I * Y N ----:----|----:----|----:----|----:----|----:----|----:----| S L G R * S * N S * C K S E L L G D L V Q Y A E R R D T V E V N L N * F V M * Y I L R E V I L * K L M * I R S S W R T C ApoI Hpy188I TspEI TspEI | TspEI | MnlI | MseI MaeIII \ \ \ \ \ \ \ ACAAAATCAGATAATTCGCCTCCAAAATTAGAAAGCGAGAATTTTAAGGATAATGAGTTG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTTTAGTCTATTAAGCGGAGGTTTTAATCTTTCGCTCTTAAAATTCCTATTACTCAAC / / // / / Hpy188I TspEI |TspEI | MseI MnlI TspEI ApoI T K S D N S P P K L E S E N F K D N E L Q N Q I I R L Q N * K A R I L R I M S W K I R * F A S K I R K R E F * G * * V G ----:----|----:----|----:----|----:----|----:----|----:----| V F D S L E G G F N S L S F K L S L S N L L I L Y N A E L I L F R S N * P Y H T C F * I I R R W F * F A L I K L I I L Q CviJI HaeIII | FatI | |SfaNI | |CviAII | || NlaIII | || | MnlI | || | | BseGI CviJI | || | | | Hin6I |AciI | || | | | |GlaI |BisI | || | | | ||HhaI ||BlsI | || | | | |||FokI MaeIII |||TauI | || | | | |||| TfiI Tsp4CI* |||| BsiYI* | || | | | |||| HinfI \ \\\\ \ \ \\ \ \ \ \\\\ \ GTAACAGTAACTAATCAGCCGCTTTTAGGCGTTGGCCTCATGGATGACGATGCGCCAGAA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CATTGTCATTGATTAGTCGGCGAAAATCCGCAACCGGAGTACCTACTGCTACGCGGTCTT / / ///// / / /// // /// / | MaeIII ||||BsiYI* | | ||| |BseGI ||| FokI Tsp4CI* |||AciI | | ||| MnlI ||Hin6I MaeIII ||BisI | | ||SfaNI |GlaI |BlsI | | |FatI HhaI CviJI | | CviAII TauI | NlaIII HaeIII CviJI V T V T N Q P L L G V G L M D D D A P E * Q * L I S R F * A L A S W M T M R Q N N S N * S A A F R R W P H G * R C A R I ----:----|----:----|----:----|----:----|----:----|----:----| T V T V L * G S K P T P R M S S S A G S P L L L * D A A K L R Q G * P H R H A L Y C Y S I L R K * A N A E H I V I R W F DdeI | Hpy188I TspEI | | TspEI BdaI | MseI | | | MnlI BdaI | VspI | | | | BspCNI | Hpy178III* | |MnlI | | | | |BseMII | |TaqI \ \\ \ \ \ \ \\ \ \\ TCCCCCTCTCAAATTAATGATTTTATTCCTCAGAAATTGATTATAGAACCCAATACTCTC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| AGGGGGAGAGTTTAATTACTAAAATAAGGAGTCTTTAACTAATATCTTGGGTTATGAGAG / /// // // // / / HinfI ||VspI |DdeI || |BseMII BdaI Hpy178III* TfiI ||MseI | || BspCNI BdaI |TspEI | |TspEI MnlI | MnlI Hpy188I S P S Q I N D F I P Q K L I I E P N T L P P L K L M I L F L R N * L * N P I L S P L S N * * F Y S S E I D Y R T Q Y S R ----:----|----:----|----:----|----:----|----:----|----:----| D G E * I L S K I G * F N I I S G L V R I G R E F * H N * E E S I S * L V W Y E G G R L N I I K N R L F Q N Y F G I S E BdaI BdaI | FatI | BspHI | |MboII AciI | |CviAII | DdeI | |Hpy178III* | Bpu10I BsmAI | || NlaIII | | Esp3I TspEI Eco31I | || | MnlI | | BsmAI \ \ \ \\ \ \ \ \ \ GAATTGAATGGTCTCACAGAAGAAACGCCTCATGACTTACCCAAGAATACCGCTAAGGGC 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAACTTACCAGAGTGTCTTCTTTGCGGAGTACTGAATGGGTTCTTATGGCGATTCCCG / / / / / // / / / / | TspEI | | | || MnlI | | BsmAI TaqI | | | |BspHI | | Esp3I | | | |FatI | Bpu10I | | | Hpy178III* | DdeI | | | CviAII AciI | | NlaIII | | MboII | BdaI | BdaI Eco31I BsmAI E L N G L T E E T P H D L P K N T A K G N * M V S Q K K R L M T Y P R I P L R A I E W S H R R N A S * L T Q E Y R * G Q ----:----|----:----|----:----|----:----|----:----|----:----| S N F P R V S S V G * S K G L F V A L P R I S H D * L L F A E H S V W S Y R * P F Q I T E C F F R R M V * G L I G S L A MboII | MboII | Hpy178III* XmnI | |TaqI MnlI MnlI BsiYI* \ \ \\ \ \ \ AGAGACGAAGAAGATTTTCCTCTCGACTATTTTCCTGTATCTGTTGAATACCCTACGGAG 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCTGCTTCTTCTAAAAGGAGAGCTGATAAAAGGACATAGACAACTTATGGGATGCCTC / / / // / / / | | | || MnlI | BsiYI* | | | |TaqI MnlI | | | Hpy178III* | | MboII | MboII XmnI R D E E D F P L D Y F P V S V E Y P T E E T K K I F L S T I F L Y L L N T L R R R R R R F S S R L F S C I C * I P Y G G ----:----|----:----|----:----|----:----|----:----|----:----| L S S S S K G R S * K G T D T S Y G V S C L R L L N E E R S N E Q I Q Q I G * P S V F F I K R E V I K R Y R N F V R R L Cac8I | TseI | AluI TspGWI | CviJI | BinI* | PvuII | | TspGWI BsiYI* | NspBII* FatI | | | MboI | BbvI | |BisI |CviAII | | | | DpnI | |CviJI | ||BlsI || NlaIII | | | | |BstKTI | ||MnlI | ||SetI || | Hin4II* \ \ \ \ \\ \ \\\ \ \\\ \\ \ \ GAAAATGCGTTTGATCCGTTCCCTCCACAGGCTTTTACGCCAGCTGCCCCTTCCATGCCT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTACGCAAACTAGGCAAGGGAGGTGTCCGAAAATGCGGTCGACGGGGAAGGTACGGA / / // / / / / / //// / /// | | || MboI BsiYI* | BbvI | |||TseI | ||Hin4II* | | |DpnI CviJI | ||BisI | |FatI | | BstKTI MnlI | |BlsI | CviAII | TspGWI | NspBII* NlaIII | BinI* | PvuII TspGWI | CviJI | AluI Cac8I SetI E N A F D P F P P Q A F T P A A P S M P K M R L I R S L H R L L R Q L P L P C L K C V * S V P S T G F Y A S C P F H A Y ----:----|----:----|----:----|----:----|----:----|----:----| S F A N S G N G G C A K V G A A G E M G P F H T Q D T G E V P K * A L Q G K W A F I R K I R E R W L S K R W S G R G H R TspDTI MaeII | MboII | SetI TfiI | |MseI MseI | TaiI HinfI | ||TspEI Ksp632I* \ \ \ \ \\\ \ ATTTCCTATGATAACGTGAATGAAAGGGATTCTATGCCCGTTAATTCTCTTCTTAATAGA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAGGATACTATTGCACTTACTTTCCCTAAGATACGGGCAATTAAGAGAAGAATTATCT / / / / / / / // | MaeII | | | | TspEI |Ksp632I* TaiI | | | MseI MseI SetI | | MboII | TspDTI HinfI TfiI I S Y D N V N E R D S M P V N S L L N R F P M I T * M K G I L C P L I L F L I D F L * * R E * K G F Y A R * F S S * * I ----:----|----:----|----:----|----:----|----:----|----:----| I E * S L T F S L S E I G T L E R R L L * K R H Y R S H F P N * A R * N E E * Y N G I I V H I F P I R H G N I R K K I S TaqII | TspRI HgiCI* | | TstI | NlaIV | | |MnlI | TspRI | | || BccI TstI | | BfiI BsrI | | || |TaqI \ \ \ \ \ \ \ \\ \\ TACCCCTATCAGTTATCAGTGGCACCCACTTTCCCAGTGCCACCATCATCATCGAGGCAA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| ATGGGGATAGTCAATAGTCACCGTGGGTGAAAGGGTCACGGTGGTAGTAGTAGCTCCGTT / / / / / / / / / / / TstI TspRI | | BfiI | | TstI MnlI | TaqI | HgiCI* | TaqII BccI NlaIV TspRI BsrI Y P Y Q L S V A P T F P V P P S S S R Q T P I S Y Q W H P L S Q C H H H H R G N P L S V I S G T H F P S A T I I I E A T ----:----|----:----|----:----|----:----|----:----|----:----| Y G * * N D T A G V K G T G G D D D L C I G R D T I L P V W K G L A V M M M S A V G I L * * H C G S E W H W W * * R P L Hpy178III* |TspDTI TspEI \\ \ CATTTTATGACAAATCGGGATTTTTATTCATCTAACAATAACAAGGAAAAATTGGTATCT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| GTAAAATACTGTTTAGCCCTAAAAATAAGTAGATTGTTATTGTTCCTTTTTAACCATAGA / / / | Hpy178III* TspEI TspDTI H F M T N R D F Y S S N N N K E K L V S I L * Q I G I F I H L T I T R K N W Y L F Y D K S G F L F I * Q * Q G K I G I S ----:----|----:----|----:----|----:----|----:----|----:----| C K I V F R S K * E D L L L L S F N T D V N * S L D P N K N M * C Y C P F I P I M K H C I P I K I * R V I V L F F Q Y R AluI CviJI | SetI | |FatI BsrI | ||CviAII TspDTI TfiI MaeI | ||| NlaIII | NmeAIII HinfI \ \ \\\ \ \ \ \ CCTAGCGACCCTACCAGCTACATGAAGTATGACGAACCAGTTATGGATTTTGATGAATCT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| GGATCGCTGGGATGGTCGATGTACTTCATACTGCTTGGTCAATACCTAAAACTACTTAGA / / / / // / / / MaeI | | | |FatI | NmeAIII HinfI | | | CviAII TspDTI TfiI | | NlaIII BsrI | CviJI | AluI SetI P S D P T S Y M K Y D E P V M D F D E S L A T L P A T * S M T N Q L W I L M N L * R P Y Q L H E V * R T S Y G F * * I S ----:----|----:----|----:----|----:----|----:----|----:----| G L S G V L * M F Y S S G T I S K S S D E * R G * W S C S T H R V L * P N Q H I R A V R G A V H L I V F W N H I K I F R TatI CfrI CfrI Tsp4CI* | BalI | CviJI Bsp1407I | CviJI | HaeIII |Csp6I TspDTI | HaeIII | | TspDTI ||RsaI | CviRI* | | Cac8I \ \ \ \\\ \ \ \ \ \ CGGCCAAATGAAAACTGTACAAATGCAAAATCTCACAACTCTGGCCAGCAAACTAAACAA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| GCCGGTTTACTTTTGACATGTTTACGTTTTAGAGTGTTGAGACCGGTCGTTTGATTTGTT / // / //// / / / | |TspDTI | |||| CviRI* | Cac8I | CfrI | |||TspDTI | CfrI HaeIII | ||Bsp1407I HaeIII CviJI | ||TatI CviJI | |Csp6I BalI | RsaI Tsp4CI* R P N E N C T N A K S H N S G Q Q T K Q G Q M K T V Q M Q N L T T L A S K L N N A K * K L Y K C K I S Q L W P A N * T T ----:----|----:----|----:----|----:----|----:----|----:----| R G F S F Q V F A F D * L E P W C V L C E A L H F S Y L H L I E C S Q G A F * V P W I F V T C I C F R V V R A L L S F L BciVI |NlaIV ||PfoI ||BssKI ||EcoRII ||| ScrFI ||| BseBI ||| | TspGWI TspEI ||| | |BceAI \ \\\ \ \\ CACCAATTATATTCTAACAACTTCCAGCAATCTTACCCAAACGGAATGGTTCCAGGATAC 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| GTGGTTAATATAAGATTGTTGAAGGTCGTTAGAATGGGTTTGCCTTACCAAGGTCCTATG / / / / / / TspEI | | | | BceAI | | | EcoRII | | | BssKI | | | PfoI | | TspGWI | | BseBI | | ScrFI | NlaIV BciVI H Q L Y S N N F Q Q S Y P N G M V P G Y T N Y I L T T S S N L T Q T E W F Q D T P I I F * Q L P A I L P K R N G S R I L ----:----|----:----|----:----|----:----|----:----|----:----| C W N Y E L L K W C D * G F P I T G P Y V G I I N * C S G A I K G L R F P E L I V L * I R V V E L L R V W V S H N W S V FatI NcoI StyI SecI* DsaI* |CviAII || NlaIII || |BinI* || |BsiYI* || ||BsiYI* || ||| MboI || ||| BamHI || ||| XhoII || ||| | DpnI || ||| | NlaIV || ||| | |BstKTI || ||| | || BinI* || ||| | || | TaqI || ||| | || | |MboI || ||| | || | || DpnI || ||| | || | || MnlI || ||| | || | || |BstKTI || ||| | || | || || CviJI \\ \\\ \ \\ \ \\ \\ \ TACCCAAAAATGCCGTATAATCCCATGGGGGGGGATCCTCTACTCGATCAAGCCTTTTAT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| ATGGGTTTTTACGGCATATTAGGGTACCCCCCCCTAGGAGATGAGCTAGTTCGGAAAATA / /// / // / / // / / | ||| | || | | || | CviJI | ||| | || | | || MboI | ||| | || | | |DpnI | ||| | || | | BstKTI | ||| | || | | MnlI | ||| | || | | TaqI | ||| | || | BinI* | ||| | || XhoII | ||| | || BamHI | ||| | || MboI | ||| | |NlaIV | ||| | |DpnI | ||| | BstKTI | ||| BinI* | ||DsaI* | ||SecI* | ||StyI | ||NcoI | ||FatI | |BsiYI* | |CviAII | BsiYI* NlaIII Y P K M P Y N P M G G D P L L D Q A F Y T Q K C R I I P W G G I L Y S I K P F M P K N A V * S H G G G S S T R S S L L W ----:----|----:----|----:----|----:----|----:----|----:----| * G F I G Y L G M P P S G R S S * A K * S G L F A T Y D W P P P D E V R D L R K V W F H R I I G H P P I R * E I L G K I Hin6I |GlaI ||AciI ||HhaI Hin4II* ||FnuDII* | BsiYI* BseGI FokI TspDTI \\\ \ \ \ \ \ GGCGCGGACGATTTTTTCTTTCCACCAGAAGGATGTGATAACAATATGCTGTATCCACAA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CCGCGCCTGCTAAAAAAGAAAGGTGGTCTTCCTACACTATTGTTATACGACATAGGTGTT /// / / / / / / ||| AciI | BsiYI* BseGI FokI TspDTI ||FnuDII* Hin4II* ||Hin6I |GlaI HhaI G A D D F F F P P E G C D N N M L Y P Q A R T I F S F H Q K D V I T I C C I H K R G R F F L S T R R M * * Q Y A V S T N ----:----|----:----|----:----|----:----|----:----|----:----| P A S S K K K G G S P H S L L I S Y G C H R P R N K R E V L L I H Y C Y A T D V A R V I K E K W W F S T I V I H Q I W L BciVI | CviRI* AluI | | FatI CviJI SetI | | |CviAII | SetI AluI | BsmAI | | || NlaIII | | MnlI CviJI | Eco31I | | || Bce83I* SmlI | | |CviRI* | SetI | | BsiYI* \ \ \\ \ \ \ \ \\ \ \ \ \ \ ACTGCAACTTCATGGAATGTTTTGCCCCCTCAAGCTATGCAACCAGCTCCAACCTATGTT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TGACGTTGAAGTACCTTACAAAACGGGGGAGTTCGATACGTTGGTCGAGGTTGGATACAA / / / /// /// / / / / / / | | | ||FatI ||| | | | | SetI BsiYI* | | | |CviAII ||| | | | CviJI | | | Bce83I* ||| | | | AluI | | NlaIII ||| | | SetI | CviRI* ||| | CviRI* BciVI ||| MnlI ||CviJI ||AluI |SmlI SetI T A T S W N V L P P Q A M Q P A P T Y V L Q L H G M F C P L K L C N Q L Q P M L C N F M E C F A P S S Y A T S S N L C W ----:----|----:----|----:----|----:----|----:----|----:----| V A V E H F T K G G * A I C G A G V * T F Q L K M S H K A G E L * A V L E L R H S C S * P I N Q G R L S H L W S W G I N MboI | DpnI | |TaqI | |BstKTI | || BssKI | || SexAI | || EcoRII | || | ScrFI FatI | || | BseBI |CviAII | || | | SetI ||BtgZI | || | | NlaIV ||| NspI | || | | | AciI ||| CviRI* MmeI TspEI | || | | | | FnuDII* ||| NlaIII \ \ \ \\ \ \ \ \ \ \\\ \ GGGAGACCATACACACCGAATTATAGATCGACACCAGGTTCCGCGATGTTCCCATACATG 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| CCCTCTGGTATGTGTGGCTTAATATCTAGCTGTGGTCCAAGGCGCTACAAGGGTATGTAC / / / // // // // / / // Eco31I MmeI | || |TaqI || || FnuDII* | |CviRI* BsmAI | || MboI || || AciI | |FatI | |DpnI || |NlaIV | CviAII | BstKTI || EcoRII NlaIII TspEI || SexAI NspI || BssKI |BseBI |ScrFI SetI G R P Y T P N Y R S T P G S A M F P Y M G D H T H R I I D R H Q V P R C S H T C E T I H T E L * I D T R F R D V P I H A ----:----|----:----|----:----|----:----|----:----|----:----| P L G Y V G F * L D V G P E A I N G Y M Q S V M C V S N Y I S V L N R S T G M C P S W V C R I I S R C W T G R H E W V H ApoI TspEI | FatI | |CviAII | || CviRI* | || NlaIII | || | PflMI | || | BsiYI* | || | | BtsI | || | | TspRI TaqI | || | | |BtsI |Hpy178III* | || | | || HphI || SduI EcoP15I | || | | || | TspRI SetI || HgiAI* \ \ \\ \ \ \\ \ \ \ \\ \ CAAAGTTCAAATTCCATGCAGTGGAACACTGCTGTTTCACCTTATAGTTCGAGAGCACCA 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTCAAGTTTAAGGTACGTCACCTTGTGACGACAAAGTGGAATATCAAGCTCTCGTGGT // // /// // / / /// |EcoP15I || ||| || HphI SetI ||HgiAI* BtgZI || ||| |TspRI ||SduI || ||| |BtsI |Hpy178III* || ||| BtsI TaqI || ||CviRI* || ||FatI || |BsiYI* || |CviAII || |PflMI || TspRI |NlaIII TspEI ApoI Q S S N S M Q W N T A V S P Y S S R A P K V Q I P C S G T L L F H L I V R E H H K F K F H A V E H C C F T L * F E S T I ----:----|----:----|----:----|----:----|----:----|----:----| C L E F E M C H F V A T E G * L E L A G A F N L N W A T S C Q Q K V K Y N S L V L T * I G H L P V S S N * R I T R S C W BccI MaeI MnlI \ \ \ TCTACAACTGCTAAAAACTATCCTCCTAGCACATTTTATTCTCAAAATATAAATCAATAC 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| AGATGTTGACGATTTTTGATAGGAGGATCGTGTAAAATAAGAGTTTTATATTTAGTTATG / / / BccI | MnlI MaeI S T T A K N Y P P S T F Y S Q N I N Q Y L Q L L K T I L L A H F I L K I * I N T Y N C * K L S S * H I L F S K Y K S I P ----:----|----:----|----:----|----:----|----:----|----:----| D V V A L F * G G L V N * E * F I F * Y M * L Q * F S D E * C M K N E F Y L D I R C S S F V I R R A C K I R L I Y I L V Tsp4CI* | BceAI SecI* | |MboII DsaI* | |BbvII* TspDTI SetI \ \ \\ \ \ CCACGGCGAAGAACTGTGGGAATGAAGTCTTCACAAGGAAATGTTCCAACAGGTAATAAA 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| GGTGCCGCTTCTTGACACCCTTACTTCAGAAGTGTTCCTTTACAAGGTTGTCCATTATTT / / / / / / / DsaI* | | | BbvII* TspDTI SetI SecI* | | BceAI | MboII Tsp4CI* P R R R T V G M K S S Q G N V P T G N K H G E E L W E * S L H K E M F Q Q V I N T A K N C G N E V F T R K C S N R * * T ----:----|----:----|----:----|----:----|----:----|----:----| G R R L V T P I F D E C P F T G V P L L G V A F F Q P F S T K V L F H E L L Y Y W P S S S H S H L R * L S I N W C T I F CviRI* | ApoI MseI MmeI | TspEI CviJI MnlI \ \ \ \ \ CAATCTGTGGGCAAGTCTGCAAAAATTTCAAAGCCTCTACATATTAAGACAAGTGCTTAT 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| GTTAGACACCCGTTCAGACGTTTTTAAAGTTTCGGAGATGTATAATTCTGTTCACGAATA / / / / / / MmeI CviRI* TspEI CviJI | MseI ApoI MnlI Q S V G K S A K I S K P L H I K T S A Y N L W A S L Q K F Q S L Y I L R Q V L I I C G Q V C K N F K A S T Y * D K C L S ----:----|----:----|----:----|----:----|----:----|----:----| C D T P L D A F I E F G R C I L V L A * V I Q P C T Q L F K L A E V Y * S L H K L R H A L R C F N * L R * M N L C T S I BssKI CviJI EcoRII | ScrFI | BseBI | | CviJI | | HaeIII | | | BcgI | | | | PflMI | | | | BsiYI* | | | | | MaeIII | | | | | Tsp45I TfiI Hpy188I | | | | | | FokI HinfI \ \ \ \ \ \ \ \ \ CAGAAGCAATACAAAATCAACTTGGAAACGAAAGCCAGGCCAAGTGCTGGTGACGAAGAT 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| GTCTTCGTTATGTTTTAGTTGAACCTTTGCTTTCGGTCCGGTTCACGACCACTGCTTCTA / / / / / / / / / Hpy188I | | | | BsiYI* | | HphI | | | | PflMI | FokI | | | BcgI Tsp45I | | EcoRII MaeIII | | HaeIII | | BssKI | | CviJI | BseBI | ScrFI CviJI Q K Q Y K I N L E T K A R P S A G D E D R S N T K S T W K R K P G Q V L V T K I E A I Q N Q L G N E S Q A K C W * R R F ----:----|----:----|----:----|----:----|----:----|----:----| * F C Y L I L K S V F A L G L A P S S S D S A I C F * S P F S L W A L H Q H R L L L L V F D V Q F R F G P W T S T V F I BetI* SfaNI BspMII* BseGI |Hin4I |HpaII |MboII || ApoI |Hpy178III* Hin4I || Hpy178III* || TspEI || TfiI |XcmI HphI || | BcgI || | TaqI || HinfI |BstXI \ \\ \ \ \\ \ \ \\ \ \\ TCTGCTCATCCTGATAAGAACAAAGAAATTTCGATGCCTACTCCGGATTCCAATACTTTG 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| AGACGAGTAGGACTATTCTTGTTTCTTTAAAGCTACGGATGAGGCCTAAGGTTATGAAAC / / / / / / / / / // / / / / | | MboII | | Hin4I | | TaqI || | | | XcmI | BseGI | BcgI | TspEI || | | BstXI HinfI Hpy178III* | ApoI || | Hin4I TfiI SfaNI || HinfI || TfiI |BspMII* |BetI* Hpy178III* HpaII S A H P D K N K E I S M P T P D S N T L L L I L I R T K K F R C L L R I P I L W C S S * * E Q R N F D A Y S G F Q Y F G ----:----|----:----|----:----|----:----|----:----|----:----| E A * G S L F L S I E I G V G S E L V K N Q E D Q Y S C L F K S A * E P N W Y K R S M R I L V F F N R H R S R I G I S Q SetI | AluI | CviJI BsaBI | MboII Hin4II* | Ecl136II | TaqI | | SetI | | BsiYI* AsuI* | | SduI | | | Bce83I* AvaII | | SacI | | | |AsuI* |BmgT120I | | HgiAI* | | | |AvaII || BsrI | | HgiJII* | | | ||BmgT120I || | Hin4II* | | | MnlI | | | |||SetI || | | Hpy188I | | | | SmlI SetI | | | |||| Hpy188I \\ \ \ \ \ \ \ \ \ \ \ \ \ \\\\ \ GTGGTCCAGTCAGAAGAAGGTGGAGCTCATTCACTTGAGGTAGATACCAATCGAAGGTCC 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| CACCAGGTCAGTCTTCTTCCACCTCGAGTAAGTGAACTCCATCTATGGTTAGCTTCCAGG /// / / / /// / // // / // // ||| | | SetI ||| MnlI |SmlI || | || |Hpy188I ||| | Hpy188I ||Ecl136II SetI || | || |AvaII ||| Hin4II* ||CviJI || | || |AsuI* ||AvaII ||AluI || | || BmgT120I ||AsuI* |MboII || | |SetI |BmgT120I HgiJII* || | Bce83I* BsrI HgiAI* || | TaqI SacI || BsiYI* SduI |BsaBI SetI Hin4II* V V Q S E E G G A H S L E V D T N R R S W S S Q K K V E L I H L R * I P I E G P G P V R R R W S S F T * G R Y Q S K V R ----:----|----:----|----:----|----:----|----:----|----:----| T T W D S S P P A * E S S T S V L R L D P P G T L L L H L E N V Q P L Y W D F T H D L * F F T S S M * K L Y I G I S P G SfaNI | SetI | | Hpy178III* | | | CviRI* | | | Hin4II* | | | | SetI \ \ \ \ \ GATAAAAACCTTCCAGATGCAACCTGA 2050 2060 ----:----|----:----|----:-- CTATTTTTGGAAGGTCTACGTTGGACT / / / // / | | | || SetI | | | |CviRI* | | | Hin4II* | | Hpy178III* | SfaNI SetI D K N L P D A T * I K T F Q M Q P X * K P S R C N L X ----:----|----:----|----:-- S L F R G S A V Q R Y F G E L H L R I F V K W I C G S # Enzymes that cut Frequency Isoschizomers AciI 6 BspACI,SsiI AhaIII* 1 DraI AluI 7 AluBI AlwNI 1 CaiI ApoI 7 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BalI 1 MlsI,MluNI,MscI,Msp20I BamHI 1 BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 3 Bce83I* 2 BpuEI BceAI 2 BcgI 1 BciVI 2 BfuI BdaI 2 BetI* 1 BsaWI BfiI 1 BmrI,BmuI BinI* 3 AlwI,BspPI,AclWI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmgT120I 2 Bpu10I 2 BsaBI 1 Bse8I,BseJI BseBI 3 Bst2UI,BstNI,BstOI,MvaI BseGI 4 BstF5I,BtsCI BseMII 1 BsiYI* 10 Bsc4I,BseLI,BslI,AfiI BsmAI 4 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI Bsp1407I 1 BsrGI,BstAUI BspCNI 1 BspHI 1 CciI,PagI,RcaI BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrI 3 BseNI,Bse1I,BsrSI BssKI 4 BstSCI,StyD4I BstKTI 6 BstXI 1 BtgZI 1 BtsI 2 Cac8I 3 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I Cfr10I 1 BsrFI,BssAI,Bse118I CfrI 2 AcoI,EaeI Csp6I 3 CviQI,RsaNI CviAII 9 CviJI 22 CviKI-1 CviRI* 9 HpyCH4V DdeI 4 BstDEI,HpyF3I DpnI 6 MalI DsaI* 2 BtgI,BstDSI Ecl136II 1 EcoICRI Eco31I 2 Bso31I,BspTNI,BsaI EcoP15I 1 EcoRII 3 AjnI,Psp6I,PspGI Esp3I 1 BsmBI FatI 9 FauI 1 SmuI FnuDII* 2 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 4 GlaI 3 HaeII 1 BstH2I HaeIII 4 BsnI,BsuRI,BshFI,PhoI HgiAI* 2 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HgiJII* 2 Eco24I,EcoT38I,FriOI,BanII HhaI 3 BstHHI,CfoI,AspLEI Hin4I 3 Hin4II* 6 HpyAV Hin6I 3 HinP1I,HspAI HinfI 9 HpaII 3 HapII,BsiSI,MspI HphI 2 AsuHPI Hpy166II 1 Hpy8I Hpy178III* 9 Hpy188III Hpy188I 11 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 4 FspBI,BfaI,XspI MaeII 1 HpyCH4IV MaeIII 4 MboI 6 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 10 MmeI 3 MnlI 18 MseI 10 Tru1I,Tru9I NcoI 1 Bsp19I NdeI 1 FauNDI NlaIII 9 Hin1II,Hsp92II,FaeI NlaIV 4 BspLI,BmiI,PspN4I NmeAIII 1 NspBII* 1 MspA1I NspI 1 BstNSI,XceI PflMI 2 BasI,AccB7I,Van91I PfoI 1 PpiI 1 PsiI 1 AanI PsrI 1 PvuII 1 RsaI 3 AfaI SacI 1 Psp124BI,SstI ScrFI 4 BmrFI,MspR9I,Bme1390I SduI 3 MhlI,Bsp1286I SecI* 2 BseDI,BssECI,BsaJI SetI 19 SexAI 1 MabI SfaNI 5 LweI SmlI 2 SmoI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 1 TaqI 8 TaqII 1 TatI 2 TauI 1 TfiI 9 PfeI TseI 1 ApeKI TsoI 2 Tsp45I 1 NmuCI Tsp4CI* 3 HpyCH4III,TaaI,Bst4CI TspDTI 11 TspEI 18 TasI,Tsp509I,Sse9I TspGWI 3 TspRI 5 TscAI TstI 1 VspI 1 PshBI,AseI XbaI 1 XcmI 1 XhoII 1 BstYI,MflI,PsuI,BstX2I XmnI 2 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflII AflIII AgeI AjuI AlfI AloI ApaI ApaLI AscI Asp718I AsuII AvaI AvrII BaeI BarI BbvCI BclI BglI BglII BmeT110I BmtI BplI BsaAI BsaXI BsePI BseRI BseSI BseYI BsgI BsiI* BslFI BsmFI Bsp120I BspLU11I* BspMI BspOI BsrBI BsrDI BssNAI Bst1107I BstAPI BstEII BstZ17I BtrI Cfr9I ClaI CspCI DinI DraII DraIII DrdI Eam1105I EciI Eco47III Eco57I Eco57MI EcoNI EcoRI EcoRV EcoT22I EgeI EheI EspI* FalI FaqI FseI FspAI GsaI GsuI HgaI HindII HindIII HpaI Hpy99I KasI KpnI MauBI McrI* MfeI MluI MlyI Mph1103I MroNI MslI MstI* MwoI NaeI NarI NgoMIV NheI NotI NruI NsiI OliI PacI PasI PleI PmaCI PmeI PpuMI PshAI PspOMI PspXI PstI PvuI RsrII SacII SalI SanDI SapI SauI* ScaI SchI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TspMI Tth111I XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769