Restriction Map of CUP1-1/YHR053C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

CUP1-1/YHR053C on chromosome VIII from coordinates 212720 to 212535.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.14116

EMBOSS_001 FatI SetI BspHI TspEI |CviAII | MseI |Hpy178III* | VspI || NlaIII | |TspEI || | TspDTI | || MseI || | | BbvI | || PacI Hin4II* || | | | XcmI \ \\ \ \ \\ \ \ \ \ ATGTTCAGCGAATTAATTAACTTCCAAAATGAAGGTCATGAGTGCCAATGCCAATGTGGT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAAGTCGCTTAATTAATTGAAGGTTTTACTTCCAGTACTCACGGTTACGGTTACACCA // // / / / // / / / / || |MseI Hin4II* | | || TspDTI | BbvI SetI || TspEI | | |BspHI XcmI |VspI | | |FatI |PacI | | Hpy178III* |MseI | | CviAII TspEI | NlaIII SetI M F S E L I N F Q N E G H E C Q C Q C G C S A N * L T S K M K V M S A N A N V V V Q R I N * L P K * R S * V P M P M W * ----:----|----:----|----:----|----:----|----:----|----:----| X N L S N I L K W F S P * S H W H W H P X T * R I L * S G F H L D H T G I G I H H E A F * N V E L I F T M L A L A L T T BbvI | TspDTI | | FatI | | |CviAII TseI | | || NlaIII AluI | | || | TseI CviJI | | || | AluI |BisI | | || | CviJI ||BlsI | | || | |BisI ||SetI | | || | ||BlsI |||CviRI* | | || | ||SetI MaeIII \\\\ \ \ \\ \ \\\ \ AGCTGCAAAAATAATGAACAATGCCAAAAATCATGTAGCTGCCCAACGGGGTGTAACAGC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TCGACGTTTTTATTACTTGTTACGGTTTTTAGTACATCGACGGGTTGCCCCACATTGTCG //// / / / /// //// / / |||CviRI* | | | ||| |||TseI | Hpy99I |||TseI | | | ||| ||BisI MaeIII ||BisI | | | ||| |BlsI |BlsI | | | ||| CviJI CviJI | | | ||| AluI AluI | | | ||SetI | | | |FatI | | | CviAII | | NlaIII | BbvI TspDTI S C K N N E Q C Q K S C S C P T G C N S A A K I M N N A K N H V A A Q R G V T A L Q K * * T M P K I M * L P N G V * Q R ----:----|----:----|----:----|----:----|----:----|----:----| L Q L F L S C H W F D H L Q G V P H L L Y S C F Y H V I G F I M Y S G L P T Y C A A F I I F L A L F * T A A W R P T V A MboII | FatI | |CviAII | || TseI | || NlaIII | || Eco57I | || Eco57MI AciI Hpy188I | || |BisI Hpy99I | MaeIII | BbvI | || ||BlsI \ \ \ \ \ \ \\ \\\ GACGACAAATGCCCCTGCGGTAACAAGTCTGAAGAAACCAAGAAGTCATGCTGCTCTGGG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCTGTTTACGGGGACGCCATTGTTCAGACTTCTTTGGTTCTTCAGTACGACGAGACCC / / / // / ////// AciI | Hpy188I || | |||||TseI MaeIII || | ||||BisI || | |||BlsI || | ||FatI || | |CviAII || | Eco57MI || | Eco57I || NlaIII |MboII BbvI D D K C P C G N K S E E T K K S C C S G T T N A P A V T S L K K P R S H A A L G R Q M P L R * Q V * R N Q E V M L L W E ----:----|----:----|----:----|----:----|----:----|----:----| S S L H G Q P L L D S S V L F D H Q E P R R C I G R R Y C T Q L F W S T M S S Q V V F A G A T V L R F F G L L * A A R P AAATGA ----:- TTTACT K * N X M X ----:- F H S I F S # Enzymes that cut Frequency Isoschizomers AciI 1 BspACI,SsiI AluI 2 AluBI BbvI 3 BseXI,BstV1I,Lsp1109I BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BspHI 1 CciI,PagI,RcaI CviAII 3 CviJI 2 CviKI-1 CviRI* 1 HpyCH4V Eco57I 1 AcuI Eco57MI 1 FatI 3 Hin4II* 1 HpyAV Hpy178III* 1 Hpy188III Hpy188I 1 Hpy99I 1 MaeIII 2 MboII 1 MseI 2 Tru1I,Tru9I NlaIII 3 Hin1II,Hsp92II,FaeI PacI 1 SetI 3 TseI 3 ApeKI TspDTI 2 TspEI 2 TasI,Tsp509I,Sse9I VspI 1 PshBI,AseI XcmI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI ApoI AscI Asp718I AsuI* AsuII AvaI AvaII AvrII BaeI BalI BamHI BarI BbvCI BbvII* BccI Bce83I* BceAI BcgI BciVI BclI BdaI BetI* BfiI BglI BglII BinI* BmeT110I BmgT120I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseBI BseGI BseMII BsePI BseRI BseSI BseYI BsgI BsiI* BsiYI* BslFI BsmAI BsmFI BsmI Bsp120I Bsp1407I BspCNI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BsrI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstF5I BstKTI BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtrI BtsCI BtsI Cac8I CauII* Cfr10I Cfr9I CfrI ClaI Csp6I CspCI CviQI DdeI DinI DpnI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoP15I EcoRI EcoRII EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FauI FnuDII* FokI FseI FspAI GlaI GsaI GsuI HaeII HaeIII HgaI HgiAI* HgiCI* HgiJII* HhaI Hin4I Hin6I HindII HindIII HinfI HinP1I HpaI HpaII HphI Hpy166II Hpy8I HspAI KasI KpnI Ksp632I* MaeI MaeII MauBI MboI McrI* MfeI MluI MlyI MmeI MnlI Mph1103I MroNI MslI MstI* MvaI MwoI NaeI NarI NcoI NdeI NgoMIV NheI NlaIV NmeAIII NotI NruI NsiI NspBII* NspI OliI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsaI RsaNI RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI ScrFI SduI SecI* SexAI SfaNI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyD4I StyI SwaI TaiI TaqI TaqII TatI TauI TfiI TsoI Tsp45I Tsp4CI* TspGWI TspMI TspRI TstI Tth111I XbaI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769