Restriction Map of ENO1/YGR254W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

ENO1/YGR254W on chromosome VII from coordinates 1000927 to 1002240.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.27291

TspGWI Hpy166II | BinI* | | MaeI | | | MboI | | | XhoII | | | | DpnI | | | | |BstKTI | | | | || MlyI | | | | || PleI | | | | || |AccI | | | | || ||Hpy166II | | | | || ||| HinfI | | | | || ||| | SecI* | | | | || ||| | DsaI* | | | | || ||| | | MaeIII Tsp4CI* CviJI BsmAI | | | | || ||| | | BstEII | TaqI \ \ \ \ \ \ \\ \\\ \ \ \ \ \ ATGGCTGTCTCTAAAGTTTACGCTAGATCCGTCTACGACTCCCGTGGTAACCCAACCGTC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCGACAGAGATTTCAAATGCGATCTAGGCAGATGCTGAGGGCACCATTGGGTTGGCAG / / / / /// / //// / / / / CviJI | | | ||| | |||AccI HinfI | | Tsp4CI* | | | ||| | ||Hpy166II | | Hpy99I | | | ||| | |PleI | BstEII | | | ||| | MlyI | MaeIII | | | ||| XhoII DsaI* | | | ||| MboI SecI* | | | ||DpnI | | | |BstKTI | | | MaeI | | BinI* | Hpy166II TspGWI BsmAI M A V S K V Y A R S V Y D S R G N P T V W L S L K F T L D P S T T P V V T Q P S G C L * S L R * I R L R L P W * P N R R ----:----|----:----|----:----|----:----|----:----|----:----| X A T E L T * A L D T * S E R P L G V T X P Q R * L K R * I R R R S G H Y G L R H S D R F N V S S G D V V G T T V W G D Hin4I Hin4I |TsoI ||BslFI |||BinI* |||| MboI Hpy99I |||| XhoII | TaqI |||| Hpy188I BccI | | TspEI |||| | DpnI | Hin4I | | | MseI |||| | |BstKTI | Hin4I \ \ \ \ \\\\ \ \\ \ \ GAAGTCGAATTAACCACCGAAAAGGGTGTTTTCAGATCCATTGTCCCATCTGGTGCTTCT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCAGCTTAATTGGTGGCTTTTCCCACAAAAGTCTAGGTAACAGGGTAGACCACGAAGA / / // / / / // // / / / TaqI | |MseI | TsoI | || || XhoII | BccI | TspEI Hin4I | || || MboI Hin4I TaqI Hin4I | || |DpnI Hin4I | || BstKTI | |Hpy188I | BslFI BinI* E V E L T T E K G V F R S I V P S G A S K S N * P P K R V F S D P L S H L V L L S R I N H R K G C F Q I H C P I W C F Y ----:----|----:----|----:----|----:----|----:----|----:----| S T S N V V S F P T K L D M T G D P A E R L R I L W R F P H K * I W Q G M Q H K F D F * G G F L T N E S G N D W R T S R Hpy166II AgeI | HindIII BetI* | | AluI Cfr10I | | CviJI MaeIII BccI BstXI |HpaII | | | SetI BccI Tsp45I |HphI | BseGI \\ \ \ \ \ \ \ \\ \ \ ACCGGTGTCCACGAAGCTTTGGAAATGAGAGATGGTGACAAATCCAAGTGGATGGGTAAG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TGGCCACAGGTGCTTCGAAACCTTTACTCTCTACCACTGTTTAGGTTCACCTACCCATTC // / / / / / / /// / || | | | HindIII BccI | ||BstXI BseGI || | | CviJI | |BccI || | | AluI | HphI || | SetI Tsp45I || Hpy166II MaeIII |Cfr10I |BetI* |AgeI HpaII T G V H E A L E M R D G D K S K W M G K P V S T K L W K * E M V T N P S G W V R R C P R S F G N E R W * Q I Q V D G * G ----:----|----:----|----:----|----:----|----:----|----:----| V P T W S A K S I L S P S L D L H I P L * R H G R L K P F S L H H C I W T S P Y G T D V F S Q F H S I T V F G L P H T L MseI | BcgI | | MaeII | | | GsuI | | | SetI | | | TaiI | | | Eco57MI | | | |HindII AluI CviRI* | | | |Hpy166II CviJI MseI FokI | Cac8I | | | || BsrDI | SetI BcgI CviJI \ \ \ \ \ \ \\ \ \ \ \ \ GGTGTTTTGCACGCTGTTAAGAACGTCAACGATGTCATTGCTCCAGCTTTCGTTAAGGCT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CCACAAAACGTGCGACAATTCTTGCAGTTGCTACAGTAACGAGGTCGAAAGCAATTCCGA / / / / / / // / / / / / / / | | Cac8I | | | || | BsrDI | | | | CviJI | CviRI* | | | || Hpy166II | | | MseI FokI | | | || HindII | | BcgI | | | |MaeII | CviJI | | | Eco57MI | AluI | | | GsuI SetI | | TaiI | | SetI | MseI BcgI G V L H A V K N V N D V I A P A F V K A V F C T L L R T S T M S L L Q L S L R L C F A R C * E R Q R C H C S S F R * G * ----:----|----:----|----:----|----:----|----:----|----:----| P T K C A T L F T L S T M A G A K T L A P H K A R Q * S R * R H * Q E L K R * P T N Q V S N L V D V I D N S W S E N L S BceAI |MseI CviJI || AsuI* HaeIII Tsp4CI* || AvaII | TaqI |Csp6I || |BmgT120I | | Hpy99I Hpy178III* ||RsaI \\ \\ \ \ \ \ \\\ AACATTGATGTTAAGGACCAAAAGGCCGTCGATGACTTCTTGATTTCTTTGGACGGTACT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTAACTACAATTCCTGGTTTTCCGGCAGCTACTGAAGAACTAAAGAAACCTGCCATGA // // // / / / // || |AvaII || TaqI Hpy178III* | |Csp6I || |AsuI* |Hpy99I | RsaI || | HaeIII Tsp4CI* || | CviJI || BmgT120I |MseI BceAI N I D V K D Q K A V D D F L I S L D G T T L M L R T K R P S M T S * F L W T V L H * C * G P K G R R * L L D F F G R Y C ----:----|----:----|----:----|----:----|----:----|----:----| L M S T L S W F A T S S K K I E K S P V * C Q H * P G F P R R H S R S K K P R Y V N I N L V L L G D I V E Q N R Q V T S BbvI |TseI |CviJI ||BisI |||BlsI |||| BbvI BbvI |||| | Hpy178III* TaqII TaqII | EcoP15I |||| | | MwoI \ \ \ \ \\\\ \ \ \ GCCAACAAATCCAAGTTGGGTGCTAACGCTATCTTGGGTGTTTCTTTGGCTGCTTCCAGA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTTGTTTAGGTTCAACCCACGATTGCGATAGAACCCACAAAGAAACCGACGAAGGTCT / / / / //// / // TaqII TaqII | | |||| | |SetI | | |||| | Hpy178III* | | |||| | BbvI | | |||| MwoI | | |||TseI | | |||BbvI | | ||BisI | | |BlsI | | CviJI | EcoP15I BbvI A N K S K L G A N A I L G V S L A A S R P T N P S W V L T L S W V F L W L L P E Q Q I Q V G C * R Y L G C F F G C F Q S ----:----|----:----|----:----|----:----|----:----|----:----| A L L D L N P A L A I K P T E K A A E L Q W C I W T P H * R * R P H K K P Q K W G V F G L Q T S V S D Q T N R Q S S G S TseI AluI CviJI |BisI ||BlsI ||SetI ||| AciI ||| BisI ||| |BlsI ||| ||TseI ||| ||TauI ||| ||MwoI ||| ||BslFI ||| ||NspBII* ||| |||BisI ||| ||||BlsI CviJI DdeI \\\ \\\\\ \ \ GCTGCCGCTGCTGAAAAGAATGTCCCATTATACAAGCACTTGGCTGACTTGTCTAAGTCC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CGACGGCGACGACTTTTCTTACAGGGTAATATGTTCGTGAACCGACTGAACAGATTCAGG /////////// / / ||||||||||BslFI CviJI DdeI |||||||||TseI ||||||||BisI |||||||BlsI ||||||NspBII* ||||||AciI |||||BisI ||||BlsI |||MwoI |||TseI |||TauI ||BisI |BlsI CviJI AluI A A A A E K N V P L Y K H L A D L S K S L P L L K R M S H Y T S T W L T C L S P C R C * K E C P I I Q A L G * L V * V Q ----:----|----:----|----:----|----:----|----:----|----:----| A A A A S F F T G N Y L C K A S K D L D L Q R Q Q F S H G M I C A S P Q S T * T S G S S F L I D W * V L V Q S V Q R L G Hpy178III* | AloI MaeII | |AclI |MnlI | |MaeII || SetI | || SetI Tsp4CI* SetI || TaiI BsrI | || TaiI | NlaIV \ \\ \ \ \ \\ \ \ \ AAGACCTCTCCATACGTTTTGCCAGTTCCATTCTTGAACGTTTTGAACGGTGGTTCCCAC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTGGAGAGGTATGCAAAACGGTCAAGGTAAGAACTTGCAAAACTTGCCACCAAGGGTG / // / / / / / / / / / SetI || | BsrI | | | MaeII | NlaIV BstXI || MaeII | | | AclI Tsp4CI* |MnlI | | TaiI TaiI | | SetI SetI | Hpy178III* AloI K T S P Y V L P V P F L N V L N G G S H R P L H T F C Q F H S * T F * T V V P T D L S I R F A S S I L E R F E R W F P R ----:----|----:----|----:----|----:----|----:----|----:----| L V E G Y T K G T G N K F T K F P P E W W S R E M R K A L E M R S R K S R H N G L G R W V N Q W N W E Q V N Q V T T G V OliI MslI CviJI | BstXI | CviRI* | | MwoI | | ApoI BsrI | | | AloI | | TspEI | DdeI SetI \ \ \ \ \ \ \ \ \ \ GCTGGTGGTGCTTTGGCTTTGCAAGAATTTATGATTGCTCCAACTGGTGCTAAGACCTTC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CGACCACCACGAAACCGAAACGTTCTTAAATACTAACGAGGTTGACCACGATTCTGGAAG / / / / / / // / | AloI | CviRI* TspEI BsrI || PpiI | MwoI CviJI ApoI |SetI MslI DdeI OliI A G G A L A L Q E F M I A P T G A K T F L V V L W L C K N L * L L Q L V L R P S W W C F G F A R I Y D C S N W C * D L R ----:----|----:----|----:----|----:----|----:----|----:----| A P P A K A K C S N I I A G V P A L V K R Q H H K P K A L I * S Q E L Q H * S R S T T S Q S Q L F K H N S W S T S L G E TspEI PpiI | XmnI |MmeI | | NlaIV ||HindIII | | | Eco57I |||Hin4II* | | | Eco57MI ||||AluI | | | |Hpy188I ||||CviJI | | | || Hpy166II ||||| SetI | | | || | PpiI Ksp632I* \\\\\ \ \ \ \ \\ \ \ \ GCTGAAGCTTTGAGAATTGGTTCCGAAGTTTACCACAACTTGAAGTCTTTGACCAAGAAG 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CGACTTCGAAACTCTTAACCAAGGCTTCAAATGGTGTTGAACTTCAGAAACTGGTTCTTC / / / / / / / / / | | | HindIII | | | Hpy166II Ksp632I* | | CviJI | | | PpiI | | AluI | | Hpy188I | Hin4II* | Eco57MI | SetI | Eco57I MmeI | NlaIV TspEI XmnI A E A L R I G S E V Y H N L K S L T K K L K L * E L V P K F T T T * S L * P R R * S F E N W F R S L P Q L E V F D Q E E ----:----|----:----|----:----|----:----|----:----|----:----| A S A K L I P E S T * W L K F D K V L F R Q L K S F Q N R L K G C S S T K S W S S F S Q S N T G F N V V V Q L R Q G L L Cfr10I |HpaII || MaeIII || | MaeII || | | SetI || | | TaiI || | | | MaeIII || | | | Tsp45I || | | | Hpy99I || | | | Hin4II* || | | | | EcoP15I Tsp4CI* || | | | | | SetI | MboII || | | | | | |HphI \ \ \\ \ \ \ \ \ \\ AGATACGGTGCTTCTGCCGGTAACGTCGGTGACGAAGGTGGTGTTGCTCCAAACATTCAA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TCTATGCCACGAAGACGGCCATTGCAGCCACTGCTTCCACCACAACGAGGTTTGTAAGTT / / // //// / / // / | MboII || |||| | | || HphI Tsp4CI* || |||| | | |EcoP15I || |||| | | SetI || |||| | Tsp45I || |||| | MaeIII || |||| Hin4II* || |||MaeII || ||MaeIII || |Hpy99I || TaiI || SetI |Cfr10I HpaII R Y G A S A G N V G D E G G V A P N I Q D T V L L P V T S V T K V V L L Q T F K I R C F C R * R R * R R W C C S K H S N ----:----|----:----|----:----|----:----|----:----|----:----| L Y P A E A P L T P S S P P T A G F M * S I R H K Q R Y R R H R L H H Q E L C E S V T S R G T V D T V F T T N S W V N L MwoI HgaI | TseI | CviJI MwoI | |BisI |HindIII | ||BlsI || AluI Eco57I | ||| MaeIII || CviJI Eco57MI | ||| Tsp45I || | SetI | BbvI | ||| | Hpy178III* || | |EcoP15I | HindII | ||| | | Hpy99I || | || MboII | Hpy166II | ||| | | Tsp4CI* \\ \ \\ \ \ \ \ \\\ \ \ \ ACTGCTGAAGAAGCTTTGGACTTGATTGTTGACGCTATCAAGGCTGCTGGTCACGACGGT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TGACGACTTCTTCGAAACCTGAACTAACAACTGCGATAGTTCCGACGACCAGTGCTGCCA / / / / / / / / / //// // / | | | | | | | | MwoI |||TseI || Tsp4CI* | | | | | | | BbvI ||HgaI |Hpy178III* | | | | | | Hpy166II ||BisI |Tsp45I | | | | | | HindII |BlsI |MaeIII | | | | | Eco57MI CviJI Hpy99I | | | | | Eco57I | | | | EcoP15I | | | | MboII | | | HindIII | | CviJI | | AluI | SetI MwoI T A E E A L D L I V D A I K A A G H D G L L K K L W T * L L T L S R L L V T T V C * R S F G L D C * R Y Q G C W S R R * ----:----|----:----|----:----|----:----|----:----|----:----| V A S S A K S K I T S A I L A A P * S P F Q Q L L K P S S Q Q R * * P Q Q D R R S S F F S Q V Q N N V S D L S S T V V T MboI MboII | DpnI | Hpy188I | |BstKTI | |ApoI | ||Hpy178III* | |TspEI | |||BsaBI | |EcoRI | ||||MboI | || MnlI Tsp4CI* | ||||| DpnI | || | FalI | Csp6I | ||||| |BstKTI Tsp4CI* | || | FalI | |RsaI \ \\\\\ \\ \ \ \\ \ \ \ \\ AAGATCAAGATCGGTTTGGACTGTGCTTCCTCTGAATTCTTCAAGGACGGTAAGTACGAC 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTAGTTCTAGCCAAACCTGACACGAAGGAGACTTAAGAAGTTCCTGCCATTCATGCTG // ///// / / / / / / // || ||||| MboI Tsp4CI* | | EcoRI | |Csp6I || ||||DpnI | | TspEI | RsaI || |||BstKTI | | MnlI Tsp4CI* || ||Hpy178III* | | ApoI || |BsaBI | | FalI || MboI | | FalI |DpnI | Hpy188I BstKTI MboII K I K I G L D C A S S E F F K D G K Y D R S R S V W T V L P L N S S R T V S T T D Q D R F G L C F L * I L Q G R * V R L ----:----|----:----|----:----|----:----|----:----|----:----| L I L I P K S Q A E E S N K L S P L Y S Y S * S R N P S H K R Q I R * P R Y T R L D L D T Q V T S G R F E E L V T L V V HindII Hpy166II | AsuI* Hpy178III* | AvaII | TfiI | |BmgT120I | HinfI | ||BsrI | | FalI | ||| MfeI CviJI | | FalI Hpy188I Hin4I | ||| TspEI |MnlI \ \ \ \ \ \ \\\ \ \\ TTGGACTTCAAGAATCCAAACTCTGACAAATCCAAGTGGTTGACTGGTCCTCAATTGGCT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| AACCTGAAGTTCTTAGGTTTGAGACTGTTTAGGTTCACCAACTGACCAGGAGTTAACCGA // / / / / / // / / / || HinfI | Hin4I | | |AvaII | | Hin4I || TfiI Hpy188I | | |AsuI* | CviJI |Hpy178III* | | | | MnlI FalI | | | TspEI FalI | | | MfeI | | BmgT120I | BsrI Hpy166II HindII L D F K N P N S D K S K W L T G P Q L A W T S R I Q T L T N P S G * L V L N W L G L Q E S K L * Q I Q V V D W S S I G * ----:----|----:----|----:----|----:----|----:----|----:----| K S K L F G F E S L D L H N V P G * N A S P S * S D L S Q C I W T T S Q D E I P Q V E L I W V R V F G L P Q S T R L Q S BsmAI |BinI* ||TaqI ||| MboI MfeI ||| XhoII Hin4I TspEI ||| |BccI |Csp6I |MboII ||| ||DpnI ||RsaI Ksp632I* ||TspDTI ||| |||BstKTI MboII \\\ \ \\\ \\\ \\\\ \ GACTTGTACCACTCCTTGATGAAGAGATACCCAATTGTCTCCATCGAAGATCCATTTGCT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CTGAACATGGTGAGGAACTACTTCTCTATGGGTTAACAGAGGTAGCTTCTAGGTAAACGA // / / / / / // / / |Csp6I Ksp632I* | TspEI | | || | MboII RsaI | MfeI | | || XhoII TspDTI | | || MboI MboII | | |BccI | | |DpnI | | BstKTI | BsmAI | TaqI BinI* D L Y H S L M K R Y P I V S I E D P F A T C T T P * * R D T Q L S P S K I H L L L V P L L D E E I P N C L H R R S I C * ----:----|----:----|----:----|----:----|----:----|----:----| S K Y W E K I F L Y G I T E M S S G N A Q S T G S R S S S I G L Q R W R L D M Q V Q V V G Q H L S V W N D G D F I W K S BsrI MboII |HindIII || AluI || CviJI || | SetI || | BfiI || | | Eco57I || | | Eco57MI || | | |MboII Hpy178III* || | | || BsmAI | AciI || | | || Eco31I | | NspBII* TspEI \\ \ \ \\ \ \ \ \ \ GAAGATGACTGGGAAGCTTGGTCTCACTTCTTCAAGACCGCTGGTATTCAAATTGTTGCT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTACTGACCCTTCGAACCAGAGTGAAGAAGTTCTGGCGACCATAAGTTTAACAACGA // / /// / / / / / || | ||| MboII | | NspBII* TspEI || | ||Eco57MI | | AciI || | ||HindIII | Hpy178III* || | ||Eco57I Eco31I || | |BfiI BsmAI || | CviJI || | AluI || SetI |MboII BsrI E D D W E A W S H F F K T A G I Q I V A K M T G K L G L T S S R P L V F K L L L R * L G S L V S L L Q D R W Y S N C C * ----:----|----:----|----:----|----:----|----:----|----:----| S S S Q S A Q D * K K L V A P I * I T A Q L H S P L K T E S R * S R Q Y E F Q Q F I V P F S P R V E E L G S T N L N N S HphI | DrdI AciI TseI | | MaeIII | BbvI CviJI | | Tsp45I | | TaqI |BisI | | Tsp4CI* TspEI | | |Hin4II* ||BlsI \ \ \ \ \ \ \\ \\\ GATGACTTGACTGTCACCAACCCAAAGAGAATTGCTACCGCTATCGAAAAGAAGGCTGCC 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTGAACTGACAGTGGTTGGGTTTCTCTTAACGATGGCGATAGCTTTTCTTCCGACGG / / / / / / / / ///// | | | Tsp45I TspEI | | TaqI ||||Hpy99I | | | MaeIII | | BbvI |||MwoI | | Tsp4CI* | Hin4II* |||TseI | DrdI AciI ||BisI HphI |BlsI CviJI D D L T V T N P K R I A T A I E K K A A M T * L S P T Q R E L L P L S K R R L P * L D C H Q P K E N C Y R Y R K E G C R ----:----|----:----|----:----|----:----|----:----|----:----| S S K V T V L G F L I A V A I S F F A A Q H S S Q * W G L S F Q * R * R F S P Q I V Q S D G V W L S N S G S D F L L S G TseI BccI Acc65I CviJI HgiCI* |BisI |Csp6I BbvI ||BlsI MwoI ||RsaI Hpy188I |||MlyI | Hpy99I SetI ||NlaIV |TfiI |||PleI | | Hin4II* |HindII ||| KpnI |HinfI ||||SmlI | | |HgaI |Hpy166II ||| | SetI ||Bce83I* |||||BbvI \ \ \\ \\ \\\ \ \ \\\ \\\\\\ GACGCTTTGTTGTTGAAGGTCAACCAAATCGGTACCTTGTCTGAATCCATCAAGGCTGCT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCGAAACAACAACTTCCAGTTGGTTTAGCCATGGAACAGACTTAGGTAGTTCCGACGA / // / / /// // / ///// | |SetI Hpy166II | ||| || HinfI ||||PleI | HgaI HindII | ||| || TfiI |||TseI Hin4II* | ||| || BbvI |||MlyI | ||| |Bce83I* ||BisI | ||| Hpy188I |BccI | ||HgiCI* |BlsI | ||Acc65I CviJI | |Csp6I | NlaIV | RsaI | SetI KpnI D A L L L K V N Q I G T L S E S I K A A T L C C * R S T K S V P C L N P S R L L R F V V E G Q P N R Y L V * I H Q G C S ----:----|----:----|----:----|----:----|----:----|----:----| S A K N N F T L W I P V K D S D M L A A R R K T T S P * G F R Y R T Q I W * P Q V S Q Q Q L D V L D T G Q R F G D L S S MboI TseI BglII |BisI XhoII ||BlsI | DpnI Hpy178III* |||Cfr10I | |BstXI | HinfI ||||HpaII | |BstKTI TspDTI \ \ \\\\\ \ \\ \ CAAGACTCTTTCGCTGCCGGTTGGGGTGTTATGGTTTCCCACAGATCTGGTGAAACTGAA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCTGAGAAAGCGACGGCCAACCCCACAATACCAAAGGGTGTCTAGACCACTTTGACTT // / /// // / // / / / || HinfI ||| |Cfr10I | || XhoII | HphI |BbvI ||| HpaII | || BglII TspDTI Hpy178III* ||TseI | || MboI SmlI |BisI | |DpnI BlsI | BstKTI BstXI Q D S F A A G W G V M V S H R S G E T E K T L S L P V G V L W F P T D L V K L K R L F R C R L G C Y G F P Q I W * N * R ----:----|----:----|----:----|----:----|----:----|----:----| * S E K A A P Q P T I T E W L D P S V S E L S K R Q R N P H * P K G C I Q H F Q L V R E S G T P T N H N G V S R T F S F BsrI BsaXI Hin4I | GsuI Eco57I | Eco57MI Eco57MI | | Hpy178III* HphI | Tth111I | | | Hin4I | BbvII* | | DrdI | | | |BsrI | | BsrDI | | | Hin4I | | | || SduI | | | MboII | | | | Hpy99I | | | || HgiAI* \ \ \ \ \ \ \ \ \ \ \ \ \\ \ GACACTTTCATTGCTGACTTGGTCGTCGGTTTGAGAACTGGTCAAATCAAGACTGGTGCT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTGAAAGTAACGACTGAACCAGCAGCCAAACTCTTGACCAGTTTAGTTCTGACCACGA / / / // / / // / // // | | | || Hpy99I | || Eco57MI || |HgiAI* | | | |Tth111I | || GsuI || |SduI | | | |DrdI | |BsrI || BsrI | | | Hin4I | BsaXI |Hin4I | | Eco57MI Hin4I Hpy178III* | | Eco57I | BbvII* | MboII BsrDI D T F I A D L V V G L R T G Q I K T G A T L S L L T W S S V * E L V K S R L V L H F H C * L G R R F E N W S N Q D W C S ----:----|----:----|----:----|----:----|----:----|----:----| S V K M A S K T T P K L V P * I L V P A L C K * Q Q S P R R N S F Q D F * S Q H V S E N S V Q D D T Q S S T L D L S T S BinI* | AluI | CviJI | |MaeI | ||SetI | |||MboI | |||XhoII | |||| DpnI | |||| |TsoI | |||| |BstKTI | |||| || BsaXI TfiI | |||| || Hpy188I CviJI MfeI HinfI | |||| || | Hin4I | TspEI TspEI | TaqI TspEI \ \\\\ \\ \ \ \ \ \ \ \ \ CCAGCTAGATCCGAAAGATTGGCTAAATTGAACCAATTGTTGAGAATCGAAGAAGAATTA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCGATCTAGGCTTTCTAACCGATTTAACTTGGTTAACAACTCTTAGCTTCTTCTTAAT /// /// / / / / / / // ||| ||| Hpy188I CviJI TspEI TspEI | TaqI |MboII ||| ||| XhoII MfeI HinfI TspEI ||| ||| MboI TfiI SetI ||| ||Hin4I ||| ||BsaXI ||| ||DpnI ||| |BstKTI ||| |TsoI ||| MaeI ||CviJI ||AluI |BinI* SetI P A R S E R L A K L N Q L L R I E E E L Q L D P K D W L N * T N C * E S K K N * S * I R K I G * I E P I V E N R R R I R ----:----|----:----|----:----|----:----|----:----|----:----| G A L D S L N A L N F W N N L I S S S N E L * I R F I P * I S G I T S F R L L I W S S G F S Q S F Q V L Q Q S D F F F * HphI | SecI* | DsaI* | | OliI | | MslI | | | MaeIII MboII | | | Tsp45I MaeIII | | | Tsp4CI* Tsp45I | | | | TspEI | SetI HphI | | | | | PsiI | |MboII | MwoI | | | | | |HphI \ \\ \ \ \ \ \ \ \ \\ GGTGACAACGCTGTTTTCGCTGGTGAAAACTTCCACCACGGTGACAAATTATAA 1270 1280 1290 1300 1310 ----:----|----:----|----:----|----:----|----:----|---- CCACTGTTGCGACAAAAGCGACCACTTTTGAAGGTGGTGCCACTGTTTAATATT / / // / /// / // | | |MwoI HphI ||| | |HphI | | HphI ||| | |PsiI | Tsp45I ||| | TspEI | MaeIII ||| Tsp45I MboII ||| MaeIII ||DsaI* ||SecI* |Tsp4CI* MslI OliI G D N A V F A G E N F H H G D K L * V T T L F S L V K T S T T V T N Y X * Q R C F R W * K L P P R * Q I I X ----:----|----:----|----:----|----:----|----:----|---- P S L A T K A P S F K W W P S L N Y L H C R Q K R Q H F S G G R H C I I T V V S N E S T F V E V V T V F * L # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AccI 1 FblI,XmiI AciI 3 BspACI,SsiI AclI 1 Psp1406I AgeI 1 AsiGI,BshTI,CspAI,PinAI AloI 1 AluI 7 AluBI ApoI 2 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BbvI 7 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 5 Bce83I* 1 BpuEI BceAI 1 BcgI 1 BetI* 1 BsaWI BfiI 1 BmrI,BmuI BglII 1 BinI* 4 AlwI,BspPI,AclWI BisI 8 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 8 BmgT120I 2 BsaBI 1 Bse8I,BseJI BsaXI 1 BseGI 1 BstF5I,BtsCI BslFI 2 BsmFI,FaqI BsmAI 3 Alw26I,BstMAI BsrDI 2 BseMI,Bse3DI BsrI 6 BseNI,Bse1I,BsrSI BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 7 BstXI 3 Cac8I 1 BstC8I Cfr10I 3 BsrFI,BssAI,Bse118I Csp6I 4 CviQI,RsaNI CviJI 18 CviKI-1 CviRI* 2 HpyCH4V DdeI 2 BstDEI,HpyF3I DpnI 7 MalI DrdI 2 AasI,DseDI DsaI* 2 BtgI,BstDSI Eco31I 1 Bso31I,BspTNI,BsaI Eco57I 4 AcuI Eco57MI 6 EcoP15I 3 EcoRI 1 FalI 2 FokI 1 GsuI 2 BpmI HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I Hin4I 5 Hin4II* 4 HpyAV HindII 4 HincII HindIII 4 HinfI 5 HpaII 3 HapII,BsiSI,MspI HphI 7 AsuHPI Hpy166II 8 Hpy8I Hpy178III* 9 Hpy188III Hpy188I 6 Hpy99I 6 KpnI 1 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 2 FspBI,BfaI,XspI MaeII 4 HpyCH4IV MaeIII 8 MboI 7 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 10 MfeI 3 MunI MlyI 2 SchI MmeI 1 MnlI 3 MseI 4 Tru1I,Tru9I MslI 2 RseI,SmiMI MwoI 7 HpyF10VI,BstMWI NlaIV 3 BspLI,BmiI,PspN4I NspBII* 2 MspA1I OliI 2 AleI PleI 2 PpsI PpiI 1 PsiI 1 AanI RsaI 4 AfaI SduI 1 MhlI,Bsp1286I SecI* 2 BseDI,BssECI,BsaJI SetI 17 SmlI 1 SmoI TaiI 4 TaqI 6 TaqII 2 TauI 1 TfiI 3 PfeI TseI 7 ApeKI TsoI 2 Tsp45I 6 NmuCI Tsp4CI* 9 HpyCH4III,TaaI,Bst4CI TspDTI 2 TspEI 12 TasI,Tsp509I,Sse9I TspGWI 1 Tth111I 1 PflFI,PsyI,AspI XhoII 5 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AcyI AflII AflIII AhaIII* AjuI AlfI AlwNI ApaI ApaLI AscI AsuII AvaI AvrII BaeI BalI BamHI BarI BbvCI BciVI BclI BdaI BglI BmeT110I BmtI BplI Bpu10I BsaAI BseBI BseMII BsePI BseRI BseSI BseYI BsgI BsiI* BsiYI* BsmI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BssKI BssNAI Bst1107I Bst2UI BstAPI BstNI BstOI BstSCI BstZ17I BtgZI BtrI BtsI CauII* Cfr9I CfrI ClaI CspCI CviAII DinI DraII DraIII Eam1105I EciI Ecl136II Eco47III EcoICRI EcoNI EcoRII EcoRV EcoT22I EgeI EheI Esp3I EspI* FatI FauI FnuDII* FseI FspAI GlaI GsaI HaeII HgiJII* HhaI Hin6I HinP1I HpaI HspAI KasI MauBI McrI* MluI Mph1103I MroNI MstI* MvaI NaeI NarI NcoI NdeI NgoMIV NheI NlaIII NmeAIII NotI NruI NsiI NspI PacI PasI PflMI PfoI PmaCI PmeI PpuMI PshAI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI ScrFI SexAI SfaNI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyD4I StyI SwaI TatI TspMI TspRI TstI VspI XbaI XcmI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769