Restriction Map of MCM6/YGL201C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

MCM6/YGL201C on chromosome VII from coordinates 120907 to 117854.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.19322

EMBOSS_001 AluI CviJI PvuII BseRI Hin4II* NspBII* | SetI | AciI BseGI | SetI BarI | | EciI | |BarI \ \ \ \ \ \ \ \ \\ ATGTCATCCCCTTTTCCAGCTGACACACCAAGCAGTAATAGACCTTCCAACTCCTCTCCG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGTAGGGGAAAAGGTCGACTGTGTGGTTCGTCATTATCTGGAAGGTTGAGGAGAGGC / / / / // / / / / BseGI | | BarI || EciI | BarI AciI | NspBII* |SetI Hin4II* | PvuII BseRI | CviJI | AluI SetI M S S P F P A D T P S S N R P S N S S P C H P L F Q L T H Q A V I D L P T P L R V I P F S S * H T K Q * * T F Q L L S A ----:----|----:----|----:----|----:----|----:----|----:----| X D D G K G A S V G L L L L G E L E E G X T M G K E L Q C V L C Y Y V K W S R E H * G R K W S V C W A T I S R G V G R R TaqI |MmeI ||BccI ||Hpy99I ||| SetI ||| | Cac8I ||| | | CviJI ||| | | | Hpy188I ||| | | | | MlyI ||| | | | | PleI ||| | | | | | AciI ||| | | | | | | HinfI ||| | | | | | | | TaqI ||| | | | | | | | | TfiI MnlI ||| | | | |MwoI | | | | HinfI CviJI \ \\\ \ \ \ \\ \ \ \ \ \ \ CCACCATCGTCGATAGGTGCTGGCTTCGGAAGCAGTAGCGGACTCGATTCGCAAATAGGC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GGTGGTAGCAGCTATCCACGACCGAAGCCTTCGTCATCGCCTGAGCTAAGCGTTTATCCG / / / /// / / // // / / / / / MnlI | | ||SetI | | |Hpy188I || | | | HinfI CviJI | | |BccI | | MwoI || | | | TfiI | | TaqI | CviJI || | | TaqI | MmeI Cac8I || | HinfI Hpy99I || AciI |PleI MlyI P P S S I G A G F G S S S G L D S Q I G H H R R * V L A S E A V A D S I R K * A T I V D R C W L R K Q * R T R F A N R L ----:----|----:----|----:----|----:----|----:----|----:----| G G D D I P A P K P L L L P S S E C I P A V M T S L H Q S R F C Y R V R N A F L W W R R Y T S A E S A T A S E I R L Y A AciI | FatI AsuI* | |CviAII DraII MaeI | || NspI |CviJI | MaeIII | || NlaIII |HaeIII | | SetI MboII | || | TspEI |BmgT120I \ \ \ \ \ \\ \ \ \\ TCTAGGTTACATTTCCCAAGTTCTTCTCAACCGCATGTCAGTAATTCACAAACAGGCCCT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AGATCCAATGTAAAGGGTTCAAGAAGAGTTGGCGTACAGTCATTAAGTGTTTGTCCGGGA // / / / // / /// |MaeI | MboII | |FatI TspEI ||DraII SetI MaeIII | CviAII ||AsuI* NlaIII |BmgT120I AciI HaeIII NspI CviJI S R L H F P S S S Q P H V S N S Q T G P L G Y I S Q V L L N R M S V I H K Q A L * V T F P K F F S T A C Q * F T N R P F ----:----|----:----|----:----|----:----|----:----|----:----| E L N C K G L E E * G C T L L E C V P G S * T V N G L N K E V A H * Y N V F L G R P * M E W T R R L R M D T I * L C A R MseI |HpaI BspCNI |HindII |BseMII |Hpy166II || SetI NlaIV || TfiI || | CviRI* | AciI || HinfI DdeI || | |BccI | | FnuDII* \\ \ \ \\ \ \\ \ \ \ TTTGTTAACGATTCCACTCAGTTTAGTTCTCAAAGGTTGCAAACCGATGGTTCCGCGACT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AAACAATTGCTAAGGTGAGTCAAATCAAGAGTTTCCAACGTTTGGCTACCAAGGCGCTGA // / / // / / / / / |MseI HinfI DdeI || SetI | BccI | FnuDII* | TfiI |BseMII CviRI* | AciI Hpy166II BspCNI NlaIV HindII HpaI F V N D S T Q F S S Q R L Q T D G S A T L L T I P L S L V L K G C K P M V P R L C * R F H S V * F S K V A N R W F R D * ----:----|----:----|----:----|----:----|----:----|----:----| K T L S E V * N L E * L N C V S P E A V K Q * R N W E T * N E F T A F R H N R S K N V I G S L K T R L P Q L G I T G R S AluI FalI CviJI FalI | SetI BspMI | | TfiI HindIII | | HinfI | AluI | | | MaeII | CviJI | | | | MseI | TspDTI | | | | SetI MnlI SetI | | SetI | | | | TaiI \ \ \ \ \ \ \ \ \ \ AATGATATGGAGGGAAATGAACCTGCCAGAAGCTTCAAAAGTAGAGCTTTGAATCACGTT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TTACTATACCTCCCTTTACTTGGACGGTCTTCGAAGTTTTCATCTCGAAACTTAGTGCAA / / / / / / / / // // MnlI SetI FalI | | HindIII | CviJI || |MaeII FalI | | BspMI | AluI || FalI | CviJI SetI || FalI | AluI |TaiI TspDTI |SetI SetI HinfI TfiI N D M E G N E P A R S F K S R A L N H V M I W R E M N L P E A S K V E L * I T L * Y G G K * T C Q K L Q K * S F E S R * ----:----|----:----|----:----|----:----|----:----|----:----| L S I S P F S G A L L K L L L A K F * T * H Y P P F H V Q W F S * F Y L K S D R I I H L S I F R G S A E F T S S Q I V N MaeII |MaeIII FalI || SetI TspGWI FalI || TaiI | BsrI HphI TaqI TspGWI \ \\ \ \ \ \ \ \ AAGAAAGTTGATGACGTTACTGGTGAAAAAGTCCGTGAAGCGTTCGAGCAGTTTTTGGAA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTTCAACTACTGCAATGACCACTTTTTCAGGCACTTCGCAAGCTCGTCAAAAACCTT / / / / / / / / MseI | | | BsrI HphI TaqI TspGWI | | MaeIII | | TspGWI | MaeII TaiI SetI K K V D D V T G E K V R E A F E Q F L E R K L M T L L V K K S V K R S S S F W K E S * * R Y W * K S P * S V R A V F G R ----:----|----:----|----:----|----:----|----:----|----:----| L F T S S T V P S F T R S A N S C N K S * S L Q H R * Q H F L G H L T R A T K P L F N I V N S T F F D T F R E L L K Q F AluI CviJI Ecl136II | SetI | SduI | SacI | HgiAI* BbvII* | HgiJII* | MboII TspRI BsrI HphI | | TspEI \ \ \ \ \ \ \ \ GACTTTTCCGTTCAATCCACTGATACTGGTGAAGTTGAAAAAGTTTATAGAGCTCAAATT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTGAAAAGGCAAGTTAGGTGACTATGACCACTTCAACTTTTTCAAATATCTCGAGTTTAA / / / / / / / | TspRI BsrI HphI | | TspEI BbvII* | Ecl136II MboII | CviJI | AluI HgiJII* HgiAI* SacI SduI SetI D F S V Q S T D T G E V E K V Y R A Q I T F P F N P L I L V K L K K F I E L K L L F R S I H * Y W * S * K S L * S S N * ----:----|----:----|----:----|----:----|----:----|----:----| S K E T * D V S V P S T S F T * L A * I L S K R E I W Q Y Q H L Q F L K Y L E F V K G N L G S I S T F N F F N I S S L N FatI ApoI TspDTI |CviAII TspEI |SetI || NlaIII \ \\ \\ \ GAATTTATGAAAATATATGACCTAAACACCATTTATATAGATTATCAGCATTTATCCATG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAAATACTTTTATATACTGGATTTGTGGTAAATATATCTAATAGTCGTAAATAGGTAC / // / // TspEI |TspDTI | |FatI ApoI SetI | CviAII NlaIII E F M K I Y D L N T I Y I D Y Q H L S M N L * K Y M T * T P F I * I I S I Y P * I Y E N I * P K H H L Y R L S A F I H E ----:----|----:----|----:----|----:----|----:----|----:----| S N I F I Y S R F V M * I S * * C K D M Q I * S F I H G L C W K Y L N D A N I W F K H F Y I V * V G N I Y I I L M * G H TsoI | SduI | HgiAI* | |MaeI | || AluI | || CviJI | || | SetI | || | | CviJI | || | | | DdeI | || | | | | Hpy188I | || | | | | | SspI | || | | | | | | BspCNI | || | | | | | | |BseMII \ \\ \ \ \ \ \ \ \\ AGAGAAAATGGTGCTCTAGCTATGGCTATCTCAGAACAATATTACAGATTTTTGCCTTTT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCTTTTACCACGAGATCGATACCGATAGAGTCTTGTTATAATGTCTAAAAACGGAAAA / /// / // /// | ||CviJI CviJI |DdeI ||BseMII | ||AluI Hpy188I |BspCNI | |MaeI SspI | SetI HgiAI* SduI TsoI R E N G A L A M A I S E Q Y Y R F L P F E K M V L * L W L S Q N N I T D F C L F R K W C S S Y G Y L R T I L Q I F A F F ----:----|----:----|----:----|----:----|----:----|----:----| L S F P A R A I A I E S C Y * L N K G K S L F H H E L * P * R L V I N C I K A K S F I T S * S H S D * F L I V S K Q R K MlyI CviRI* PleI Ksp632I* | SetI | MaeIII |MseI MboII | |TspEI MseI | Tsp45I \\ \ \ \\ \ \ \ TTACAAAAGGGTTTAAGAAGAGTAGTAAGAAAGTATGCACCTGAATTGTTAAACACAAGT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| AATGTTTTCCCAAATTCTTCTCATCATTCTTTCATACGTGGACTTAACAATTTGTGTTCA / / // / / // Ksp632I* MboII |SetI | | |PleI MseI CviRI* | | MlyI | MseI TspEI L Q K G L R R V V R K Y A P E L L N T S Y K R V * E E * * E S M H L N C * T Q V T K G F K K S S K K V C T * I V K H K * ----:----|----:----|----:----|----:----|----:----|----:----| K C F P K L L T T L F Y A G S N N F V L K V F P N L F L L L F T H V Q I T L C L * L L T * S S Y Y S L I C R F Q * V C T HinfI | Ksp632I* | | BinI* | | | BdaI | | | BdaI | | | MboI | | | XhoII | | | Hin4II* | | | | DpnI | | | | |BstKTI | | | | || Hpy188I | | | | || | MboII | | | | || | |MaeIII | | | | || | |Tsp45I | | | | || | |Hin4II* | | | | || | || PshAI | | | | || | || | SetI BseGI FokI | | | | || | || | |HphI | BdaI | MboII | | | | || | || SetI | || AciI | BdaI | |TspDTI \ \ \ \ \\ \ \\ \ \ \\ \ \ \ \ \\ GACTCATTGAAGAGATCCGAAGGTGACGAAGGTCAAGCGGATGAAGATGAGCAACAGGAC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CTGAGTAACTTCTCTAGGCTTCCACTGCTTCCAGTTCGCCTACTTCTACTCGTTGTCCTG // / / // // / // / / / / / / / / || | | || || | || | | HphI | | BdaI | FokI || | | || || | || | PshAI | | BdaI TspDTI || | | || || | || | SetI | BseGI MboII || | | || || | || Tsp45I AciI || | | || || | || MaeIII || | | || || | |Hin4II* || | | || || | MboII || | | || || | SetI || | | || || Hpy188I || | | || || XhoII || | | || || MboI || | | || |DpnI || | | || BstKTI || | | |Hin4II* || | | BdaI || | | BdaI || | BinI* || Ksp632I* |HinfI Tsp45I MaeIII D S L K R S E G D E G Q A D E D E Q Q D T H * R D P K V T K V K R M K M S N R T L I E E I R R * R R S S G * R * A T G R ----:----|----:----|----:----|----:----|----:----|----:----| S E N F L D S P S S P * A S S S S C C S H S M S S I R L H R L D L P H L H A V P V * Q L S G F T V F T L R I F I L L L V TaqI | HinfI | | AccI | | |Hin4I | | |Hin4I | | |TspDTI | | |Hpy166II | | || PleI | | || |MlyI | | || || TfiI | | || || HinfI | | || || | Hpy178III* | | || || | | MboI | | || || | | | DpnI | | || || | | | |BstKTI | | || || | | | || BinI* | | || || | | | || |CviJI | | || || | | | || ||AciI | | || || | | | || ||BisI | | || || | | | || |||BlsI | | || || | | | || ||||TauI | | || || | | | || ||||| BssKI | | || || | | | || ||||| EcoRII | | || || | | | || ||||| |SecI* | | || || | | | || ||||| ||ScrFI | | || || | | | || ||||| ||BseBI | | || || | | | || ||||| ||BsiYI* | | || || | | | || ||||| |||Hin4I | | || || | | | || ||||| |||Hin4I | | || || | | | || ||||| |||| PflMI | | || || | | | || ||||| |||| BsiYI* \ \ \\ \\ \ \ \ \\ \\\\\ \\\\ \ GATGATATGAATGGGTCGAGTCTACCAAGAGATTCTGGATCATCAGCCGCACCAGGGAAT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTATACTTACCCAGCTCAGATGGTTCTCTAAGACCTAGTAGTCGGCGTGGTCCCTTA // //// / / /// / ///// /// || |||| PleI | ||| MboI ||||| ||EcoRII || |||| MlyI | ||DpnI ||||| ||BssKI || |||AccI | |BstKTI ||||| ||SecI* || ||Hpy166II | | ||||| |BsiYI* || |HinfI | | ||||| |PflMI || TspDTI | | ||||| BseBI |TaqI | | ||||| ScrFI Hin4I | | ||||BsiYI* Hin4I | | |||Hin4I | | |||Hin4I | | |||AciI | | ||BisI | | |BlsI | | BinI* | | CviJI | | TauI | Hpy178III* HinfI TfiI D D M N G S S L P R D S G S S A A P G N M I * M G R V Y Q E I L D H Q P H Q G M * Y E W V E S T K R F W I I S R T R E W ----:----|----:----|----:----|----:----|----:----|----:----| S S I F P D L R G L S E P D D A A G P F R H Y S H T S D V L L N Q I M L R V L S I I H I P R T * W S I R S * * G C W P I FatI NcoI StyI SecI* DsaI* MaeII |CviAII |MaeIII || MnlI |Tsp45I || |BslFI || SetI MaeII || |NlaIII SetI HphI || TaiI SetI AflIII \\ \\ \ \ \\ \ \ \ GGGACATCTGCCATGGCAACGAGGTCAATAACAACTTCTACGTCACCTGAACAGACGGAA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CCCTGTAGACGGTACCGTTGCTCCAGTTATTGTTGAAGATGCAGTGGACTTGTCTGCCTT / /// / / / / / / / / | ||| | SetI HphI | | | Tsp45I TaiI | ||| BslFI | | | MaeIII SetI | ||DsaI* | | SetI | ||SecI* | MaeII | ||StyI TaiI | ||NcoI SetI | ||FatI | |CviAII | MnlI NlaIII G T S A M A T R S I T T S T S P E Q T E G H L P W Q R G Q * Q L L R H L N R R N D I C H G N E V N N N F Y V T * T D G T ----:----|----:----|----:----|----:----|----:----|----:----| P V D A M A V L D I V V E V D G S C V S H S M Q W P L S T L L L K * T V Q V S P P C R G H C R P * Y C S R R * R F L R F Tsp4CI* | Hpy166II | | Hin4I | | Hin4I | | |ApoI | | |TspEI | | |EcoRI | | || Hpy178III* | | || | MboI | | || | BglII SetI TspGWI | | || | XhoII TaiI | MboII | | || | | DpnI \ \ \ \ \ \\ \ \ \ CGTGTTTTTCAAATCAGTTTCTTCAATCTACCAACAGTTCACAGAATTCGTGATATAAGA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| GCACAAAAAGTTTAGTCAAAGAAGTTAGATGGTTGTCAAGTGTCTTAAGCACTATATTCT / / / / / // / / // | | | MboII | |Hpy166II | | |DpnI | | TspGWI | Hin4I | | BstKTI | AflIII | Hin4I | Hpy178III* MaeII Tsp4CI* EcoRI TspEI ApoI R V F Q I S F F N L P T V H R I R D I R V F F K S V S S I Y Q Q F T E F V I * D C F S N Q F L Q S T N S S Q N S * Y K I ----:----|----:----|----:----|----:----|----:----|----:----| R T K * I L K K L R G V T * L I R S I L V H K E F * N R * D V L L E C F E H Y L T N K L D T E E I * W C N V S N T I Y S MaeIII Tsp45I Tsp4CI* | TspRI | BseMII | |BspCNI | || MnlI | || BslFI | || |TspGWI | || || DdeI | || || |Hpy188I | || || || AsuI* Hin4I | || || || AvaII BstKTI Hin4I | || || || |BmgT120I | Hpy188I |Hpy166II | || || || ||SetI \ \ \\ \ \\ \\ \\ \\\ TCTGAAAAGATTGGTTCACTATTGAGTATATCAGGGACAGTGACAAGAACATCTGAGGTC 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| AGACTTTTCTAACCAAGTGATAACTCATATAGTCCCTGTCACTGTTCTTGTAGACTCCAG / / / / / /// / // // // Hpy188I Hin4I Hpy166II | | ||| | || || |AvaII XhoII Hin4I | | ||| | || || |AsuI* BglII | | ||| | || || BmgT120I MboI | | ||| | || |DdeI | | ||| | || SetI | | ||| | |Hpy188I | | ||| | BslFI | | ||| TspGWI | | ||| MnlI | | ||Tsp45I | | ||MaeIII | | |BspCNI | | BseMII | Tsp4CI* TspRI S E K I G S L L S I S G T V T R T S E V L K R L V H Y * V Y Q G Q * Q E H L R S * K D W F T I E Y I R D S D K N I * G P ----:----|----:----|----:----|----:----|----:----|----:----| D S F I P E S N L I D P V T V L V D S T I Q F S Q N V I S Y I L S L S L F M Q P R F L N T * * Q T Y * P C H C S C R L D Cac8I HindIII | AluI | CviJI | | SetI | | |BceAI | | || MaeII Hpy178III* | | || AflIII | FalI | | || |BsaAI | FalI | | || || SetI FalI | TspEI | | || || TaiI FalI MaeII \ \ \ \ \\ \\ \ \ \ CGTCCAGAATTATACAAGGCAAGCTTTACGTGTGATATGTGCCGTGCTATCGTAGATAAC 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| GCAGGTCTTAATATGTTCCGTTCGAAATGCACACTATACACGGCACGATAGCATCTATTG / / / / / / //// / / / | | TspEI | | | |||| | FalI TaiI | Hpy178III* | | | |||| | FalI SetI FalI | | | |||| AflIII FalI | | | |||MaeII | | | ||BsaAI | | | |BceAI | | | TaiI | | | SetI | | HindIII | CviJI | AluI Cac8I SetI R P E L Y K A S F T C D M C R A I V D N V Q N Y T R Q A L R V I C A V L S * I T S R I I Q G K L Y V * Y V P C Y R R * R ----:----|----:----|----:----|----:----|----:----|----:----| R G S N Y L A L K V H S I H R A I T S L G D L I I C P L S * T H Y T G H * R L Y T W F * V L C A K R T I H A T S D Y I V TatI |Csp6I ||RsaI FatI |||Hpy166II |CviAII SetI ||||Hin4II* || NlaIII TaiI Tsp4CI* ||||| TspRI || |BccI \ \ \\\\\ \ \\ \\ GTAGAACAGTCCTTCAAGTACACTGAACCGACATTTTGCCCGAACCCATCATGCGAAAAT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CATCTTGTCAGGAAGTTCATGTGACTTGGCTGTAAAACGGGCTTGGGTAGTACGCTTTTA / / //// / // / MaeII Tsp4CI* |||TatI | || BccI ||Hpy166II | |FatI ||Hin4II* | CviAII ||Csp6I NlaIII |RsaI TspRI V E Q S F K Y T E P T F C P N P S C E N * N S P S S T L N R H F A R T H H A K I R T V L Q V H * T D I L P E P I M R K * ----:----|----:----|----:----|----:----|----:----|----:----| T S C D K L Y V S G V N Q G F G D H S F R L V T R * T C Q V S M K G S G M M R F Y F L G E L V S F R C K A R V W * A F I MaeIII | BinI* | | MboI | | XhoII | | | DpnI | | | |BssKI | | | |EcoRII | | | |BstKTI | | | || ScrFI Hpy188I | | | || BseBI |ApoI | | | || | SetI |TspEI CviJI MseI | | | || | | Hpy178III* |EcoRI \ \ \ \ \ \\ \ \ \ \\ AGAGCCTTTTGGACATTAAATGTTACAAGATCCAGGTTTCTTGATTGGCAAAAAGTCAGA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCGGAAAACCTGTAATTTACAATGTTCTAGGTCCAAAGAACTAACCGTTTTTCAGTCT / / / / // /// / / / CviJI MseI | | || ||| | Hpy178III* Hpy188I | | || ||| EcoRII | | || ||| BssKI | | || ||BseBI | | || ||ScrFI | | || |SetI | | || XhoII | | || MboI | | |DpnI | | BstKTI | MaeIII BinI* R A F W T L N V T R S R F L D W Q K V R E P F G H * M L Q D P G F L I G K K S E S L L D I K C Y K I Q V S * L A K S Q N ----:----|----:----|----:----|----:----|----:----|----:----| L A K Q V N F T V L D L N R S Q C F T L Y L R K S M L H * L I W T E Q N A F L * S G K P C * I N C S G P K K I P L F D S CviJI |NlaIV || FatI || |CviAII || || NlaIII || || |AciI || || |BisI MboII || || ||BlsI |AcyI || || |||TauI |MaeII || || |||FnuDII* ||ZraI || || ||||SplI* ||| SetI || || |||||Csp6I ||| TaiI SfeI* || || ||||||RsaI ||| AatII Hpy178III* |SetI || || ||||||MwoI ||| | MnlI \ \\ \\ \\ \\\\\\\ \\\ \ \ ATTCAAGAAAATGCTAACGAAATACCTACAGGCTCCATGCCGCGTACGCTGGACGTCATT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGTTCTTTTACGATTGCTTTATGGATGTCCGAGGTACGGCGCATGCGACCTGCAGTAA / / / / // / ///// /// // // / | Hpy178III* SetI | || | ||||| ||| || || MnlI EcoRI | || | ||||| ||| || |MaeII TspEI | || | ||||| ||| || |AcyI ApoI | || | ||||| ||| || ZraI | || | ||||| ||| |AatII | || | ||||| ||| |TaiI | || | ||||| ||| |SetI | || | ||||| ||| MboII | || | ||||| ||SplI* | || | ||||| |Csp6I | || | ||||| RsaI | || | ||||FnuDII* | || | ||||MwoI | || | ||||AciI | || | |||BisI | || | ||BlsI | || | |FatI | || | |TauI | || | CviAII | || NlaIII | |NlaIV | CviJI SfeI* I Q E N A N E I P T G S M P R T L D V I F K K M L T K Y L Q A P C R V R W T S F S R K C * R N T Y R L H A A Y A G R H S ----:----|----:----|----:----|----:----|----:----|----:----| I * S F A L S I G V P E M G R V S S T M F E L F H * R F V * L S W A A Y A P R * N L F I S V F Y R C A G H R T R Q V D N CviJI | BssKI | CviJI | EcoRII | | ScrFI | | BseBI | | | MaeIII | | | Tsp45I | | | BstEII | | | | SetI | | | | | Tsp4CI* | | | | | | CviRI* | | | | | | | ApoI TaqI | | | | | | | HphI TaqI SetI | HphI | | | | | | | TspEI \ \ \ \ \ \ \ \ \ \ \ \ CTTCGAGGTGATAGTGTCGAAAGAGCCAAGCCAGGTGACCGTTGCAAATTTACGGGTGTG 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| GAAGCTCCACTATCACAGCTTTCTCGGTTCGGTCCACTGGCAACGTTTAAATGCCCACAC / // / / // / / // / TaqI |TaqI | | || | | |HphI TspEI SetI HphI | | || | | | ApoI | | || | | CviRI* | | || | Tsp4CI* | | || | BstEII | | || | Tsp45I | | || | MaeIII | | || EcoRII | | || BssKI | | |BseBI | | |ScrFI | | SetI | CviJI CviJI L R G D S V E R A K P G D R C K F T G V F E V I V S K E P S Q V T V A N L R V W S R * * C R K S Q A R * P L Q I Y G C G ----:----|----:----|----:----|----:----|----:----|----:----| R R P S L T S L A L G P S R Q L N V P T E E L H Y H R F L W A L H G N C I * P H K S T I T D F S G L W T V T A F K R T H CviJI | BssKI | SexAI Csp6I | EcoRII |RsaI | | ScrFI || SetI MfeI | | BseBI TspEI || | MaeIII TspEI | | | SetI CviJI \ \\ \ \ \ \ \ \ \ \ GAAATTGTAGTACCTGATGTTACACAATTGGGGCTACCAGGTGTGAAGCCAAGTTCAACA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTAACATCATGGACTACAATGTGTTAACCCCGATGGTCCACACTTCGGTTCAAGTTGT / // / / / // / / | |Csp6I | | | || EcoRII CviJI | RsaI | | | || SexAI | SetI | | | || BssKI TspEI | | | |BseBI | | | |ScrFI | | | SetI | | CviJI | TspEI | MfeI MaeIII E I V V P D V T Q L G L P G V K P S S T K L * Y L M L H N W G Y Q V * S Q V Q H N C S T * C Y T I G A T R C E A K F N I ----:----|----:----|----:----|----:----|----:----|----:----| S I T T G S T V C N P S G P T F G L E V P F Q L V Q H * V I P A V L H S A L N L F N Y Y R I N C L Q P * W T H L W T * C MaeIII Hin4II* | Eco57I SetI | BbvII* | Eco57MI MnlI | TaqI | | MboII | | BsrI | MaeI | AsuII | | | SetI | | |Hpy166II \ \ \ \ \ \ \ \ \ \ \\ TTAGATACTAGAGGTATTTCGAAGACTACTGAAGGTTTGAATAGTGGTGTTACTGGTTTA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| AATCTATGATCTCCATAAAGCTTCTGATGACTTCCAAACTTATCACCACAATGACCAAAT / // / / / / / / / MnlI |SetI | Hin4II* BbvII* | | | Hpy166II MaeI AsuII MboII | | BsrI TaqI SetI | MaeIII Eco57MI Eco57I L D T R G I S K T T E G L N S G V T G L * I L E V F R R L L K V * I V V L L V Y R Y * R Y F E D Y * R F E * W C Y W F T ----:----|----:----|----:----|----:----|----:----|----:----| N S V L P I E F V V S P K F L P T V P K M L Y * L Y K S S * Q L N S Y H H * Q N * I S S T N R L S S F T Q I T T N S T * FatI |CviAII ||Cac8I ||| SphI ||| NspI ||| NlaIII ||| |FatI ||| ||CviAII Hpy178III* AluI ||| ||| FalI | FalI CviJI ||| ||| FalI | FalI | SetI ||| ||| |NlaIII \ \ \ \ \\\ \\\ \\ CGCTCTCTTGGTGTTCGTGATTTGACATACAAGATTAGCTTTCTGGCATGCCATGTTATC 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| GCGAGAGAACCACAAGCACTAAACTGTATGTTCTAATCGAAAGACCGTACGGTACAATAG // / / / //// // |Hpy178III* | CviJI | |||| |FatI FalI | AluI | |||| CviAII FalI SetI | |||NlaIII | ||FatI | |CviAII | |FalI | |FalI | Cac8I NlaIII NspI SphI R S L G V R D L T Y K I S F L A C H V I A L L V F V I * H T R L A F W H A M L S L S W C S * F D I Q D * L S G M P C Y Q ----:----|----:----|----:----|----:----|----:----|----:----| R E R P T R S K V Y L I L K R A H W T I V S E Q H E H N S M C S * S E P M G H * A R K T N T I Q C V L N A K Q C A M N D MboI | DpnI CviRI* CviRI* | |BstKTI | SfaNI | ApoI | || BinI* | | CviJI | TspEI BbvI \ \\ \ \ \ \ \ \ \ AGTATTGGATCAAACATTGGTGCAAGTAGCCCTGATGCAAATTCTAACAACCGAGAAACT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TCATAACCTAGTTTGTAACCACGTTCATCGGGACTACGTTTAAGATTGTTGGCTCTTTGA // / / / // / / || MboI BinI* | |CviJI | TspEI |DpnI | SfaNI | ApoI BstKTI CviRI* CviRI* S I G S N I G A S S P D A N S N N R E T V L D Q T L V Q V A L M Q I L T T E K L Y W I K H W C K * P * C K F * Q P R N * ----:----|----:----|----:----|----:----|----:----|----:----| L I P D F M P A L L G S A F E L L R S V * Y Q I L C Q H L Y G Q H L N * C G L F T N S * V N T C T A R I C I R V V S F S TseI AccI CviJI |BssNAI |BisI AluI |Hpy166II MboI BccI ||BlsI CviJI ||BdaI | DpnI |SfeI* ||| TspEI | SetI ||BdaI | |BstKTI \\ \\\ \ \ \ \\\ \ \\ GAACTACAGATGGCTGCTAATTTACAAGCTAATAATGTATACCAAGATAATGAAAGAGAT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGATGTCTACCGACGATTAAATGTTCGATTATTACATATGGTTCTATTACTTTCTCTA / / //// / / / /// // | | |||TseI | | CviJI ||AccI |DpnI | | ||BisI | | AluI |Hpy166II BstKTI | | |BlsI | SetI |BssNAI | | CviJI TspEI BdaI | SfeI* BdaI BccI BbvI E L Q M A A N L Q A N N V Y Q D N E R D N Y R W L L I Y K L I M Y T K I M K E I T T D G C * F T S * * C I P R * * K R S ----:----|----:----|----:----|----:----|----:----|----:----| S S C I A A L K C A L L T Y W S L S L S Q V V S P Q * N V L * Y H I G L Y H F L F * L H S S I * L S I I Y V L I I F S I Hin4II* | AluI Hpy178III* | CviJI Hpy178III* | BdaI | | SetI | TspDTI | BdaI Tsp4CI* Hpy188I | | TspDTI \ \ \ \ \ \ \ \ \ CAAGAAGTATTCTTGAACAGTTTGAGTTCAGATGAAATAAATGAGCTGAAGGAAATGGTA 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCTTCATAAGAACTTGTCAAACTCAAGTCTACTTTATTTACTCGACTTCCTTTACCAT / / / / / / / / / | | | | Tsp4CI* Hpy188I | | TspDTI | | | Hpy178III* | | CviJI | | BdaI | | AluI | | BdaI | SetI | Hpy178III* Hin4II* | TspDTI MboI Q E V F L N S L S S D E I N E L K E M V K K Y S * T V * V Q M K * M S * R K W * R S I L E Q F E F R * N K * A E G N G K ----:----|----:----|----:----|----:----|----:----|----:----| * S T N K F L K L E S S I F S S F S I T D L L I R S C N S N L H F L H A S P F P L F Y E Q V T Q T * I F Y I L Q L F H Y Eco57I Eco57MI | BseGI | | MslI AluI | | | FokI CviJI | | | | TspDTI PvuII | | | | | TspEI NspBII* | | | | | | GsuI | SetI | | | | | | Eco57MI | |BceAI | | | | | | | MboI | || CfrI | | | | | | | BglII | || | BalI | | | | | | | XhoII | || | CviJI | | | | | | | Hpy188I | || | HaeIII | | | | | | | | DpnI | || | |FatI | | | | | | | | |BstKTI | || | ||CviAII \ \ \ \ \ \ \ \ \\ \ \\ \ \\\ AAGGATGAACATATTTATGATAAATTGGTCAGATCTATTGCTCCAGCTGTGTTTGGCCAT 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCTACTTGTATAAATACTATTTAACCAGTCTAGATAACGAGGTCGACACAAACCGGTA / / / / / / / / // / / / / ///// | BseGI | | | | | | || XhoII | | | ||||CviAII Eco57MI | | | | | | || BglII | | | |||FalI Eco57I | | | | | | || MboI | | | |||FalI | | | | | | |DpnI | | | ||CfrI | | | | | | BstKTI | | | |NlaIII | | | | | Hpy188I | | | HaeIII | | | | TspEI | | | CviJI | | | Eco57MI | | | BalI | | | GsuI | | BceAI | | FokI | NspBII* | TspDTI | PvuII MslI | CviJI | AluI SetI K D E H I Y D K L V R S I A P A V F G H R M N I F M I N W S D L L L Q L C L A M G * T Y L * * I G Q I Y C S S C V W P * ----:----|----:----|----:----|----:----|----:----|----:----| F S S C I * S L N T L D I A G A T N P W L P H V Y K H Y I P * I * Q E L Q T Q G L I F M N I I F Q D S R N S W S H K A M NlaIII | FalI | FalI TatI | CviJI |Csp6I | | Hin4II* Hpy188I ||RsaI | | | Eco57I |MwoI ||ScaI | | | Eco57MI || TspDTI |||Hin4II* | | | | TspDTI || | FalI ||||SfeI* | | | | | SfaNI || | FalI |||||Tsp4CI* \ \ \ \ \ \ \\ \ \ \\\\\\ GAAGCCGTAAAGAAGGGTATCTTGCTTCAGATGCTCGGTGGTGTTCATAAGAGTACTGTA 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCGGCATTTCTTCCCATAGAACGAAGTCTACGAGCCACCACAAGTATTCTCATGACAT / // / / / // // /// / | || | TspDTI | || |TspDTI ||| SfeI* | || Eco57MI | || FalI ||Tsp4CI* | || Eco57I | || FalI ||TatI | |Hin4II* | |Hpy188I |Csp6I | CviJI | MwoI Hin4II* FatI SfaNI ScaI RsaI E A V K K G I L L Q M L G G V H K S T V K P * R R V S C F R C S V V F I R V L * S R K E G Y L A S D A R W C S * E Y C R ----:----|----:----|----:----|----:----|----:----|----:----| S A T F F P I K S * I S P P T * L L V T H L R L S P Y R A E S A R H H E Y S Y Q F G Y L L T D Q K L H E T T N M L T S Y SetI BinI* | MseI Hin4I | Hin4I | MboI HphI | | MnlI | | DpnI | DdeI | | | MseI EcoRV BseRI | | |BstKTI | |MnlI \ \ \ \ \ \ \ \ \\ \ \\ GAAGGTATTAAGTTAAGAGGAGATATCAACATCTGTGTTGTTGGTGATCCCTCTACTTCT 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCCATAATTCAATTCTCCTCTATAGTTGTAGACACAACAACCACTAGGGAGATGAAGA // // / / / / / // / / / |Hin4I |MseI MseI EcoRV | Hin4I | || MboI HphI MnlI SetI MnlI BseRI | |DpnI | BstKTI BinI* E G I K L R G D I N I C V V G D P S T S K V L S * E E I S T S V L L V I P L L L R Y * V K R R Y Q H L C C W * S L Y F * ----:----|----:----|----:----|----:----|----:----|----:----| S P I L N L P S I L M Q T T P S G E V E L L Y * T L L L Y * C R H Q Q H D R * K F T N L * S S I D V D T N N T I G R S R TspEI CviRI* |BsmAI | MboI || MseI | | DpnI || |AhaIII* | | |BstKTI || || MaeII | | || EcoP15I || || |BsaAI | | || | Hpy166II || || |SnaBI | | || | | BetI* || || || SetI | | || | | |HpaII || || || TaiI | | || | | || BbvI \\ \\ \\ \ \ \ \\ \ \ \\ \ AAGTCTCAATTTTTAAAATACGTAGTGGGATTTGCACCAAGATCAGTTTACACTTCCGGT 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| TTCAGAGTTAAAAATTTTATGCATCACCCTAAACGTGGTTCTAGTCAAATGTGAAGGCCA / // // / // / // / / // DdeI || || | |MaeII CviRI* || | Hpy166II |BetI* || || | SnaBI || | EcoP15I HpaII || || | BsaAI || MboI || || TaiI |DpnI || || SetI BstKTI || |MseI || AhaIII* |BsmAI TspEI K S Q F L K Y V V G F A P R S V Y T S G S L N F * N T * W D L H Q D Q F T L P V V S I F K I R S G I C T K I S L H F R * ----:----|----:----|----:----|----:----|----:----|----:----| L D * N K F Y T T P N A G L D T * V E P * T E I K L I R L P I Q V L I L K C K R L R L K * F V Y H S K C W S * N V S G T StuI CviJI HaeIII | BglI TseI | MwoI AluI | | Hpy99I CviJI | | |TseI PvuII | | |CviJI NspBII* | | ||BisI |BisI | | |||BbvI ||BlsI MnlI | | |||BlsI ||SetI | Hin4II* | | |||MnlI MseI |||AciI | | MnlI SetI \ \ \\\\ \ \\\\ \ \ \ \ AAGGCCTCGTCGGCTGCTGGTTTAACAGCTGCGGTTGTGAGAGATGAGGAAGGAGGTGAT 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCGGAGCAGCCGACGACCAAATTGTCGACGCCAACACTCTCTACTCCTTCCTCCACTA / / //// / / / //// / / / / / | | |||| BbvI | | |||| AciI | | MnlI SetI | | |||TseI | | |||TseI | Hin4II* | | ||BisI | | ||BisI MnlI | | |MnlI | | |BlsI | | |BlsI | | NspBII* | | CviJI | | PvuII | Hpy99I | | CviJI | MwoI | | AluI | BglI | SetI HaeIII MseI CviJI StuI BbvI K A S S A A G L T A A V V R D E E G G D R P R R L L V * Q L R L * E M R K E V I G L V G C W F N S C G C E R * G R R * L ----:----|----:----|----:----|----:----|----:----|----:----| L A E D A A P K V A A T T L S S S P P S Y P R T P Q Q N L L Q P Q S L H P L L H L G R R S S T * C S R N H S I L F S T I AarI BspMI |MfeI |TspEI SetI TaqI ApoI || HphI | MseI Cac8I Tsp4CI* ClaI TspEI \\ \ \ \ \ \ \ \ TATACAATTGAAGCAGGTGCTTTAATGCTTGCTGATAACGGTATTTGTTGTATCGATGAA 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| ATATGTTAACTTCGTCCACGAAATTACGAACGACTATTGCCATAAACAACATAGCTACTT / // / / / / / | || SetI MseI Cac8I Tsp4CI* ClaI | |TspEI TaqI | |MfeI | BspMI | AarI HphI Y T I E A G A L M L A D N G I C C I D E I Q L K Q V L * C L L I T V F V V S M N Y N * S R C F N A C * * R Y L L Y R * I ----:----|----:----|----:----|----:----|----:----|----:----| * V I S A P A K I S A S L P I Q Q I S S N Y L Q L L H K L A Q Q Y R Y K N Y R H I C N F C T S * H K S I V T N T T D I F FatI BspHI |CviAII MboI |Hpy178III* Hpy188I || NlaIII | DpnI || | AluI | |BstKTI || | CviJI TspDTI | ||TspDTI || | | SetI TspDTI \ \ \\\ \\ \ \ \ \ TTTGATAAAATGGATATTTCAGATCAAGTTGCCATTCATGAAGCTATGGAACAACAGACC 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| AAACTATTTTACCTATAAAGTCTAGTTCAACGGTAAGTACTTCGATACCTTGTTGTCTGG / / / // / / /// / / TspEI TspDTI | || MboI | ||| CviJI TspDTI ApoI | |TspDTI | ||| AluI | |DpnI | ||SetI | BstKTI | |BspHI Hpy188I | |FatI | Hpy178III* | CviAII NlaIII F D K M D I S D Q V A I H E A M E Q Q T L I K W I F Q I K L P F M K L W N N R P * * N G Y F R S S C H S * S Y G T T D H ----:----|----:----|----:----|----:----|----:----|----:----| N S L I S I E S * T A M * S A I S C C V I Q Y F P Y K L D L Q W E H L * P V V S K I F H I N * I L N G N M F S H F L L G BbvI | TspEI | | MaeI AluI MseI | | | AciI CviJI |AhaIII* | | | |BisI BccI | SetI || CviRI* | | | ||BlsI \ \ \ \\ \ \ \ \ \\\ ATCTCTATTGCTAAAGCTGGTATTCACGCTACTTTAAATGCAAGAACATCAATTCTAGCG 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| TAGAGATAACGATTTCGACCATAAGTGCGATGAAATTTACGTTCTTGTAGTTAAGATCGC / / / // / / / //// BccI | CviJI || CviRI* | | |||BisI | AluI |MseI | | |||AciI SetI AhaIII* | | ||BlsI | | |TauI | | MaeI | TspEI BbvI I S I A K A G I H A T L N A R T S I L A S L L L K L V F T L L * M Q E H Q F * R L Y C * S W Y S R Y F K C K N I N S S G ----:----|----:----|----:----|----:----|----:----|----:----| M E I A L A P I * A V K F A L V D I R A W R * Q * L Q Y E R * K L H L F M L E L D R N S F S T N V S S * I C S C * N * R BssKI DdeI TseI | HpaII | TspRI TauI | ScrFI MboII | | TspEI CviJI | CauII* | BseMII | | | MseI |BisI | | BsiYI* | |BspCNI | | | |SwaI ||BlsI | | | SetI | || MnlI | | | |AhaIII* \\\ \ \ \ \ \ \\ \ \ \ \ \\ GCTGCCAACCCGGTAGGTGGAAGATACAATAGGAAACTATCACTGAGGGGTAATTTAAAT 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| CGACGGTTGGGCCATCCACCTTCTATGTTATCCTTTGATAGTGACTCCCCATTAAATTTA //// //// /// // / /// |||TseI |||SetI ||| |TspRI DdeI ||MseI ||BisI ||BsiYI* ||| MnlI |AhaIII* |BlsI ||BssKI ||BspCNI |SwaI CviJI |HpaII |BseMII TspEI CauII* MboII ScrFI A A N P V G G R Y N R K L S L R G N L N L P T R * V E D T I G N Y H * G V I * I C Q P G R W K I Q * E T I T E G * F K Y ----:----|----:----|----:----|----:----|----:----|----:----| A A L G T P P L Y L L F S D S L P L K F P Q W G P L H F I C Y S V I V S P Y N L S G V R Y T S S V I P F * * Q P T I * I MboI | DpnI | |FatI | |BstKTI | ||CviAII Hpy178III* | ||| NlaIII | MaeIII AciI | ||| | Hpy178III* | Tsp4CI* \ \ \\\ \ \ \ \ ATGACCGCACCGATCATGTCCAGATTTGATTTATTTTTTGTTATTCTTGATGACTGTAAC 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| TACTGGCGTGGCTAGTACAGGTCTAAACTAAATAAAAAACAATAAGAACTACTGACATTG / //// // / / / / AciI |||| || Hpy178III* | | MaeIII |||| |FatI | Tsp4CI* |||| CviAII Hpy178III* |||MboI ||NlaIII |DpnI BstKTI M T A P I M S R F D L F F V I L D D C N * P H R S C P D L I Y F L L F L M T V T D R T D H V Q I * F I F C Y S * * L * R ----:----|----:----|----:----|----:----|----:----|----:----| I V A G I M D L N S K N K T I R S S Q L Y S R V S * T W I Q N I K Q * E Q H S Y H G C R D H G S K I * K K N N K I V T V SfaNI | HindII | Hpy166II | | FatI | | |CviAII | | || Esp3I | | || BsmAI TspEI TspEI | | || |NlaIII \ \ \ \ \\ \\ GAAAAAATTGATACCGAATTGGCATCTCATATCGTTGACTTACACATGAAAAGAGACGAA 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTTTAACTATGGCTTAACCGTAGAGTATAGCAACTGAATGTGTACTTTTCTCTGCTT / / // / // / / TspEI TspEI || | || BsmAI TspDTI || | || Esp3I || | |FatI || | CviAII || NlaIII |Hpy166II |HindII SfaNI E K I D T E L A S H I V D L H M K R D E K K L I P N W H L I S L T Y T * K E T K K N * Y R I G I S Y R * L T H E K R R S ----:----|----:----|----:----|----:----|----:----|----:----| S F I S V S N A D * I T S K C M F L S S R F F Q Y R I P M E Y R Q S V C S F L R F F N I G F Q C R M D N V * V H F S V F CviRI* | MaeII CviJI MaeII | |BsaAI |AciI | SetI | ||Csp6I |BisI | TaiI | |||RsaI CviJI ||BlsI | | Hpy99I | |||SetI TspDTI |||TauI CviRI* | | | BsgI | |||TaiI \ \\\\ \ \ \ \ \ \ \\\\ GCCATTGAGCCGCCATTTAGTGCAGAACAACTACGTCGTTATATCAAATATGCACGTACT 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTAACTCGGCGGTAAATCACGTCTTGTTGATGCAGCAATATAGTTTATACGTGCATGA / //// / // / / // //// CviJI |||AciI CviRI* || | BsgI || |||Csp6I ||BisI || MaeII || ||RsaI |BlsI |Hpy99I || |MaeII CviJI TaiI || BsaAI TauI SetI |TaiI |SetI CviRI* A I E P P F S A E Q L R R Y I K Y A R T P L S R H L V Q N N Y V V I S N M H V L H * A A I * C R T T T S L Y Q I C T Y F ----:----|----:----|----:----|----:----|----:----|----:----| A M S G G N L A S C S R R * I L Y A R V L W Q A A M * H L V V V D N Y * I H V Y G N L R W K T C F L * T T I D F I C T S TaqI |Hpy178III* MseI SspI || BseMII DdeI |AhaIII* | MseI CviJI || |BspCNI | SfaNI \\ \ \ \ \\ \\ \ \ TTTAAACCAATATTAACGAAAGAAGCCCGTTCCTATTTAGTCGAGAAGTATAAGGAACTG 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| AAATTTGGTTATAATTGCTTTCTTCGGGCAAGGATAAATCAGCTCTTCATATTCCTTGAC // / / / // // |MseI | MseI CviJI || |BspCNI AhaIII* SspI || BseMII |Hpy178III* TaqI F K P I L T K E A R S Y L V E K Y K E L L N Q Y * R K K P V P I * S R S I R N * * T N I N E R S P F L F S R E V * G T E ----:----|----:----|----:----|----:----|----:----|----:----| K L G I N V F S A R E * K T S F Y L S S K * V L I L S L L G N R N L R S T Y P V K F W Y * R F F G T G I * D L L I L F Q BseGI | BssKI | SecI* | EcoRII | |PasI | |SecI* MboI | ||ScrFI | DpnI | ||BseBI | |TaqI TfiI | ||| FokI | |BstKTI HinfI Tsp4CI* \ \\\ \ \ \\ \ \ AGAAAGGATGATGCCCAGGGATTTAGTAGATCGAGTTATAGAATCACAGTTAGGCAACTT 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTTCCTACTACGGGTCCCTAAATCATCTAGCTCAATATCTTAGTGTCAATCCGTTGAA / / / /// / // // / / | SfaNI BseGI ||| FokI || |TaqI | Tsp4CI* DdeI ||EcoRII || MboI HinfI ||BssKI |DpnI TfiI ||SecI* BstKTI |SecI* |PasI BseBI ScrFI R K D D A Q G F S R S S Y R I T V R Q L E R M M P R D L V D R V I E S Q L G N L K G * C P G I * * I E L * N H S * A T * ----:----|----:----|----:----|----:----|----:----|----:----| L F S S A W P N L L D L * L I V T L C S S F P H H G P I * Y I S N Y F * L * A V S L I I G L S K T S R T I S D C N P L K Hpy188I | AluI | CviJI | |MnlI CviJI TspEI | ||SetI | TspEI TaqI | TspDTI \ \\\ \ \ \ \ \ GAAAGTATGATTAGATTATCAGAAGCTATTGCGAGGGCTAATTGTGTCGATGAAATTACT 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTCATACTAATCTAATAGTCTTCGATAACGCTCCCGATTAACACAGCTACTTTAATGA / / / / / / / / | | CviJI CviJI TspEI TaqI | TspEI | | AluI TspDTI | | MnlI | SetI Hpy188I E S M I R L S E A I A R A N C V D E I T K V * L D Y Q K L L R G L I V S M K L L K Y D * I I R S Y C E G * L C R * N Y S ----:----|----:----|----:----|----:----|----:----|----:----| S L I I L N D S A I A L A L Q T S S I V Q F Y S * I I L L * Q S P * N H R H F * F T H N S * * F S N R P S I T D I F N S TspDTI | BsrDI | |BccI | || CviRI* | || | HindIII | || | | AluI | || | | CviJI | || | | | SetI | || | | | | MboI | || | | | | | DpnI | || | | | | | |BstKTI | || | | | | | || MseI \ \\ \ \ \ \ \ \\ \ CCATCATTCATTGCAGAAGCTTACGATCTTTTAAGGCAAAGTATTATTCGTGTTGATGTG 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| GGTAGTAAGTAACGTCTTCGAATGCTAGAAAATTCCGTTTCATAATAAGCACAACTACAC / / / / / / / // / / | | | | | | | || MboI MseI | | | | | | | |DpnI | | | | | | | BstKTI | | | | | | HindIII | | | | | CviJI | | | | | AluI | | | | SetI | | | CviRI* | | BccI | BsrDI TspDTI P S F I A E A Y D L L R Q S I I R V D V H H S L Q K L T I F * G K V L F V L M W I I H C R S L R S F K A K Y Y S C * C G ----:----|----:----|----:----|----:----|----:----|----:----| G D N M A S A * S R K L C L I I R T S T E M M * Q L L K R D K L A F Y * E H Q H W * E N C F S V I K * P L T N N T N I H AciI FokI MaeIII BisI BseGI | Hin4I Tsp45I |BlsI |ApoI | |MboII |PleI ||TauI BseGI FokI |TspEI | ||TspDTI HinfI ||MlyI ||| Hpy178III* \ \ \\ \ \\\ \ \\\ \\\ \ GATGATGTGGAAATGGATGAAGAATTTGATAACATAGAGAGTCAAAGTCACGCCGCTTCT 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTACACCTTTACCTACTTCTTAAACTATTGTATCTCTCAGTTTCAGTGCGGCGAAGA / / / // / / / / ///// / BseGI | BseGI || | FokI HinfI | ||||| Hin4I FokI || TspDTI | ||||AciI || MboII | |||BisI |TspEI | ||BlsI |ApoI | |TauI Hin4I | Tsp45I | MaeIII PleI MlyI D D V E M D E E F D N I E S Q S H A A S M M W K W M K N L I T * R V K V T P L L * C G N G * R I * * H R E S K S R R F W ----:----|----:----|----:----|----:----|----:----|----:----| S S T S I S S S N S L M S L * L * A A E P H H P F P H L I Q Y C L S D F D R R K I I H F H I F F K I V Y L T L T V G S R BfiI |SetI Tth111I |BslFI Hin4I BccI | BsrI || TspEI CviJI \ \ \ \ \\ \ \ GGAAACAATGATGACAATGATGATGGGACTGGGTCAGGTGTAATTACGAGTGAGCCACCA 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| CCTTTGTTACTACTGTTACTACTACCCTGACCCAGTCCACATTAATGCTCACTCGGTGGT / / / / / / / / Hpy178III* BccI | | BfiI | TspEI CviJI | SetI BslFI Tth111I BsrI G N N D D N D D G T G S G V I T S E P P E T M M T M M M G L G Q V * L R V S H Q K Q * * Q * * W D W V R C N Y E * A T S ----:----|----:----|----:----|----:----|----:----|----:----| P F L S S L S S P V P D P T I V L S G G Q F C H H C H H H S Q T L H L * S H A V S V I I V I I I P S P * T Y N R T L W W AluI CviJI |SfeI* |EcoP15I ||SetI ||| AluI ||| CviJI ||| | SetI ||| | | BssKI ||| | | EcoRII ||| | | | ScrFI ||| | | | BseBI ||| | | | | Csp6I ||| | | | | |RsaI Hin4II* MboII ||| | | | | |SetI \ \ \\\ \ \ \ \ \\ GCAGATATAGAAGAAGGACAAAGCGAAGCTACAGCTCGTCCAGGTACAAGCGAGAAGAAG 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| CGTCTATATCTTCTTCCTGTTTCGCTTCGATGTCGAGCAGGTCCATGTTCGCTCTTCTTC / / / / //// // /// Hin4II* | | | |||CviJI || ||Csp6I | | | |||AluI || |RsaI | | | ||SfeI* || EcoRII | | | |SetI || BssKI | | | EcoP15I |BseBI | | CviJI |ScrFI | | AluI SetI | SetI MboII A D I E E G Q S E A T A R P G T S E K K Q I * K K D K A K L Q L V Q V Q A R R R R Y R R R T K R S Y S S S R Y K R E E E ----:----|----:----|----:----|----:----|----:----|----:----| A S I S S P C L S A V A R G P V L S F F L L Y L L L V F R L * L E D L Y L R S S C I Y F F S L A F S C S T W T C A L L L FatI |CviAII MboII || NlaIII | MboII || | FatI | MaeIII || | |CviAII | Tsp45I || | || MboI | Tsp4CI* || | || |NlaIII | | MaeII || | || ||DpnI | | | SetI || | || |||BstKTI | | | TaiI HphI || | || |||| TspDTI \ \ \ \ \ \\ \ \\ \\\\ \ AAAACAACGGTGACGTATGATAAATATGTGTCCATGATGAACATGATCGTTAGAAAGATT 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTGTTGCCACTGCATACTATTTATACACAGGTACTACTTGTACTAGCAATCTTTCTAA / / / // / / // / /// / / | | | || HphI | |FatI | ||| | TspDTI | | | |MaeII | | | ||| MboI | | | Tsp45I | | | ||DpnI | | | MaeIII | | | |BstKTI | | TaiI | | | |FatI | | SetI | | | CviAII | Tsp4CI* | | NlaIII | MboII | CviAII MboII NlaIII K T T V T Y D K Y V S M M N M I V R K I K Q R * R M I N M C P * * T * S L E R L N N G D V * * I C V H D E H D R * K D C ----:----|----:----|----:----|----:----|----:----|----:----| F V V T V Y S L Y T D M I F M I T L F I S F L P S T H Y I H T W S S C S R * F S F C R H R I I F I H G H H V H D N S L N AluI CviJI PvuII MboII CviRI* NspBII* |Eco57I | SetI MnlI |Eco57MI | | BsgI \ \\ \ \ \ GCTGAAGTAGATAGGGAGGGTGCAGAAGAACTAACAGCTGTGGATATAGTTGATTGGTAT 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| CGACTTCATCTATCCCTCCCACGTCTTCTTGATTGTCGACACCTATATCAACTAACCATA / // /// / MnlI |CviRI* ||| BsgI Eco57MI ||NspBII* Eco57I ||PvuII ||CviJI ||AluI |MboII SetI A E V D R E G A E E L T A V D I V D W Y L K * I G R V Q K N * Q L W I * L I G I * S R * G G C R R T N S C G Y S * L V F ----:----|----:----|----:----|----:----|----:----|----:----| A S T S L S P A S S S V A T S I T S Q Y Q Q L L Y P P H L L V L L Q P Y L Q N T S F Y I P L T C F F * C S H I Y N I P I SspI Hin4II* |Ksp632I* MboII \ \\ \ TTATTACAGAAGGAAAATGATTTGGGTTCGTTAGCAGAATATTGGGAAGAGAGAAGATTA 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| AATAATGTCTTCCTTTTACTAAACCCAAGCAATCGTCTTATAACCCTTCTCTCTTCTAAT / / / / Hin4II* | Ksp632I* MboII SspI L L Q K E N D L G S L A E Y W E E R R L Y Y R R K M I W V R * Q N I G K R E D * I T E G K * F G F V S R I L G R E K I S ----:----|----:----|----:----|----:----|----:----|----:----| K N C F S F S K P E N A S Y Q S S L L N N I V S P F H N P N T L L I N P L S F I * * L L F I I Q T R * C F I P F L S S * TfiI HinfI | FatI | |CviAII | || Acc65I | || HgiCI* | || NlaIII | || |Csp6I | || ||RsaI MseI | || ||NlaIV MboII SetI TspDTI | || ||| KpnI \ \ \ \ \\ \\\ \ GCGTTCAAAGTCATAAAAAGGTTGGTCAAAGATAGGATTTTAATGGAGATTCATGGTACC 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| CGCAAGTTTCAGTATTTTTCCAACCAGTTTCTATCCTAAAATTACCTCTAAGTACCATGG / / / / / // /// MboII SetI | MseI | || ||HgiCI* TspDTI | || ||Acc65I | || |Csp6I | || NlaIV | || RsaI | |FatI | |KpnI | CviAII NlaIII HinfI TfiI A F K V I K R L V K D R I L M E I H G T R S K S * K G W S K I G F * W R F M V P V Q S H K K V G Q R * D F N G D S W Y Q ----:----|----:----|----:----|----:----|----:----|----:----| A N L T M F L N T L S L I K I S I * P V L T * L * L F T P * L Y S K L P S E H Y R E F D Y F P Q D F I P N * H L N M T G MboI BglII XhoII | DpnI | |BstKTI FokI | ||SmlI TspDTI TspEI | ||Hpy178III* |Tsp4CI* | MseI | ||| MnlI Bce83I* ||TspDTI \ \ \ \\\ \ \ \\\ AGACACAATTTAAGAGATCTTGAGAATGAGGAAAATGAAAATAATAAAACTGTTTATGTT 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| TCTGTGTTAAATTCTCTAGAACTCTTACTCCTTTTACTTTTATTATTTTGACAAATACAA / / // /// / / / / / | | || ||| SmlI Bce83I* | | FokI | | || ||Hpy178III* | Tsp4CI* | | || |MnlI | TspDTI | | || XhoII TspDTI | | || BglII | | || MboI | | |DpnI | | BstKTI | MseI TspEI R H N L R D L E N E E N E N N K T V Y V D T I * E I L R M R K M K I I K L F M L T Q F K R S * E * G K * K * * N C L C Y ----:----|----:----|----:----|----:----|----:----|----:----| L C L K L S R S F S S F S F L L V T * T W V C N L L D Q S H P F H F Y Y F Q K H S V I * S I K L I L F I F I I F S N I N MnlI | Tsp4CI* | | SetI | | | MboI | | | | DpnI | | | | |BstKTI | | | | ||MfeI | | | | ||TspEI AluI | | | | ||| BinI* TfiI CviJI BseGI | | | | ||| | NlaIV HinfI | SetI \ \ \ \ \ \\\ \ \ \ \ \ ATTCATCCAAACTGTGAGGTTTTGGATCAATTGGAACCACAGGATTCCAGCTAA 3010 3020 3030 3040 3050 ----:----|----:----|----:----|----:----|----:----|---- TAAGTAGGTTTGACACTCCAAAACCTAGTTAACCTTGGTGTCCTAAGGTCGATT / / / / // / // / / / / BseGI | | SetI || | || NlaIV | | CviJI | Tsp4CI* || | |BinI* | | AluI MnlI || | TspEI | SetI || | MfeI HinfI || MboI TfiI |DpnI BstKTI I H P N C E V L D Q L E P Q D S S * F I Q T V R F W I N W N H R I P A X S S K L * G F G S I G T T G F Q L X ----:----|----:----|----:----|----:----|----:----|---- I * G F Q S T K S * N S G C S E L * * E D L S H P K P D I P V V P N W S N M W V T L N Q I L Q F W L I G A L # Enzymes that cut Frequency Isoschizomers AarI 1 AatII 1 Acc65I 1 Asp718I AccI 2 FblI,XmiI AciI 12 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 2 AhaIII* 4 DraI AluI 19 AluBI ApoI 7 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BalI 1 MlsI,MluNI,MscI,Msp20I BarI 1 BbvI 4 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 7 Bce83I* 1 BpuEI BceAI 2 BdaI 4 BetI* 1 BsaWI BfiI 1 BmrI,BmuI BglI 1 BglII 3 BinI* 6 AlwI,BspPI,AclWI BisI 9 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 9 BmgT120I 2 BsaAI 3 BstBAI,Ppu21I BseBI 6 Bst2UI,BstNI,BstOI,MvaI BseGI 7 BstF5I,BtsCI BseMII 5 BseRI 2 BsgI 2 BsiYI* 3 Bsc4I,BseLI,BslI,AfiI BslFI 3 BsmFI,FaqI BsmAI 2 Alw26I,BstMAI BspCNI 5 BspHI 1 CciI,PagI,RcaI BspMI 2 BfuAI,Acc36I,BveI BsrDI 1 BseMI,Bse3DI BsrI 4 BseNI,Bse1I,BsrSI BssKI 7 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 16 Cac8I 4 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I CfrI 1 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 7 CviQI,RsaNI CviAII 14 CviJI 42 CviKI-1 CviRI* 11 HpyCH4V DdeI 6 BstDEI,HpyF3I DpnI 16 MalI DraII 1 EcoO109I DsaI* 1 BtgI,BstDSI EciI 1 Ecl136II 1 EcoICRI Eco57I 4 AcuI Eco57MI 5 EcoP15I 2 EcoRI 2 EcoRII 6 AjnI,Psp6I,PspGI EcoRV 1 Eco32I Esp3I 1 BsmBI FalI 8 FatI 14 FnuDII* 2 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 6 GsuI 1 BpmI HaeIII 3 BsnI,BsuRI,BshFI,PhoI HgiAI* 2 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII Hin4I 6 Hin4II* 11 HpyAV HindII 2 HincII HindIII 3 HinfI 11 HpaI 1 KspAI HpaII 2 HapII,BsiSI,MspI HphI 9 AsuHPI Hpy166II 9 Hpy8I Hpy178III* 14 Hpy188III Hpy188I 11 Hpy99I 3 KpnI 1 Ksp632I* 3 Eam1104I,EarI,Bst6I MaeI 4 FspBI,BfaI,XspI MaeII 11 HpyCH4IV MaeIII 13 MboI 16 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 16 MfeI 3 MunI MlyI 4 SchI MmeI 1 MnlI 16 MseI 17 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 4 HpyF10VI,BstMWI NcoI 1 Bsp19I NlaIII 14 Hin1II,Hsp92II,FaeI NlaIV 4 BspLI,BmiI,PspN4I NspBII* 4 MspA1I NspI 2 BstNSI,XceI PasI 1 PflMI 1 BasI,AccB7I,Van91I PleI 4 PpsI PshAI 1 BstPAI,BoxI PvuII 4 RsaI 7 AfaI SacI 1 Psp124BI,SstI ScaI 1 BmcAI,AssI,ZrmI ScrFI 7 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 4 BseDI,BssECI,BsaJI SetI 58 SexAI 1 MabI SfaNI 4 LweI SfeI* 4 BstSFI,SfcI,BfmI SmlI 1 SmoI SnaBI 1 Eco105I,BstSNI SphI 1 PaeI,BbuI SplI* 1 Pfl23II,PspLI,BsiWI SspI 3 StuI 1 Eco147I,PceI,SseBI,AatI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I SwaI 1 SmiI TaiI 11 TaqI 11 TatI 2 TauI 5 TfiI 7 PfeI TseI 4 ApeKI TsoI 1 Tsp45I 7 NmuCI Tsp4CI* 12 HpyCH4III,TaaI,Bst4CI TspDTI 20 TspEI 26 TasI,Tsp509I,Sse9I TspGWI 4 TspRI 4 TscAI Tth111I 1 PflFI,PsyI,AspI XhoII 5 BstYI,MflI,PsuI,BstX2I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AbsI AclI AflII AgeI AjuI AlfI AloI AlwNI ApaI ApaLI AscI AvaI AvrII BaeI BamHI BbvCI BcgI BciVI BclI BmeT110I BmtI BplI Bpu10I BsaBI BsaXI BsePI BseSI BseYI BsiI* BsmI Bsp120I Bsp1407I BspLU11I* BspMII* BspOI BsrBI BstAPI BstXI BtgZI BtrI BtsI Cfr10I Cfr9I CspCI DinI DraIII DrdI Eam1105I Eco31I Eco47III EcoNI EcoT22I EgeI EheI EspI* FauI FseI FspAI GlaI GsaI HaeII HgaI HhaI Hin6I HinP1I HspAI KasI MauBI McrI* MluI Mph1103I MroNI MstI* NaeI NarI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI OliI PacI PfoI PmaCI PmeI PpiI PpuMI PsiI PspOMI PspXI PsrI PstI PvuI RsrII SacII SalI SanDI SapI SauI* SfiI SfoI SgfI SgrAI SgrDI SmaI SpeI SrfI Sse232I* Sse8387I TaqII TspMI TstI VspI XbaI XcmI XhoI XmaCI XmaI XmaIII* XmnI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769