Restriction Map of GAT1/YFL021W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

GAT1/YFL021W on chromosome VI from coordinates 95966 to 97498.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.26589

FatI CviRI* |CviAII | MaeII BtgZI || NspI | | SetI | TspDTI || NlaIII | | TaiI EciI AciI | | Hin4II* || | CviRI* \ \ \ \ \ \ \ \ \\ \ \ ATGCACGTTTTCTTTCCTTTGCTTTTCCGCCCTTCCCCTGTTCTGTTCATCGCATGTGCA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGTGCAAAAGAAAGGAAACGAAAAGGCGGGAAGGGGACAAGACAAGTAGCGTACACGT // / / / / / / / // / || MaeII EciI AciI | | Hin4II* | || CviRI* |TaiI | BtgZI | |FatI |SetI TspDTI | CviAII CviRI* NlaIII NspI M H V F F P L L F R P S P V L F I A C A C T F S F L C F S A L P L F C S S H V H A R F L S F A F P P F P C S V H R M C I ----:----|----:----|----:----|----:----|----:----|----:----| X C T K K G K S K R G E G T R N M A H A X A R K R E K A K G G K G Q E T * R M H H V N E K R Q K E A R G R N Q E D C T C TatI Bsp1407I |Csp6I ||RsaI |||Hpy166II |||| Tsp4CI* |||| |ApaLI |||| || CviRI* |||| || Hpy166II |||| || | SduI |||| || | BseSI |||| || | HgiAI* |||| || | | Tsp4CI* |||| || | | | Hpy166II |||| || | | |OliI | MslI |||| || | | |MslI | | BslFI \\\\ \\ \ \ \\ \ \ \ TATATATATATAGATATATATATACATTGTACACGGTGCACGGTAGTGAACATAACTATG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| ATATATATATATCTATATATATATGTAACATGTGCCACGTGCCATCACTTGTATTGATAC /// / / / // / / / / ||| | | | || MslI | MslI HgiAI* ||| | | | || OliI Hpy166II SduI ||| | | | |Tsp4CI* ||| | | | ApaLI ||| | | Hpy166II ||| | | CviRI* ||| | HgiAI* ||| | BseSI ||| | SduI ||| Tsp4CI* ||Bsp1407I ||TatI |Hpy166II |Csp6I RsaI Y I Y I D I Y I H C T R C T V V N I T M I Y I * I Y I Y I V H G A R * * T * L * Y I Y R Y I Y T L Y T V H G S E H N Y E ----:----|----:----|----:----|----:----|----:----|----:----| Y I Y I S I Y I C Q V R H V T T F M V I M Y I Y L Y I Y V N Y V T C P L S C L * I Y I Y I Y I Y M T C P A R Y H V Y S H HinfI | Hpy178III* | | PleI | | |MlyI | | || TaqI | | || SetI | | || | BssKI AsuI* | | || | |BsiYI* AvaII | | || | ||HpaII ApoI DraII | | || | ||ScrFI TspEI PpuMI SduI | | || | ||CauII* | MseI |NlaIV HgiAI* | | || | ||| MnlI | |AhaIII* Hin4I |BmgT120I \ \ \ \\ \ \\\ \ \ \\ \ \\ AGCACGAACAGAGTCCCGAACCTCGACCCGGACTTGAATTTAAACAAAGAAATCTGGGAC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TCGTGCTTGTCTCAGGGCTTGGAGCTGGGCCTGAACTTAAATTTGTTTCTTTAGACCCTG / / / // // /// /// / /// BslFI | | || || ||BssKI ||| Hin4I ||PpuMI | | || || |HpaII ||MseI ||DraII | | || || |MnlI |AhaIII* ||AvaII | | || || CauII* TspEI ||AsuI* | | || || ScrFI ApoI |BmgT120I | | || |TaqI NlaIV | | || BsiYI* SetI | | |PleI | | |MlyI | | SetI | Hpy178III* HinfI S T N R V P N L D P D L N L N K E I W D A R T E S R T S T R T * I * T K K S G T H E Q S P E P R P G L E F K Q R N L G P ----:----|----:----|----:----|----:----|----:----|----:----| L V F L T G F R S G S K F K F L S I Q S S C S C L G S G R G P S S N L C L F R P A R V S D R V E V R V Q I * V F F D P V TatI SetI |Csp6I ||RsaI ||| AvaI ||| XhoI ||| SmlI ||| PspXI ||| |TaqI ||| |BmeT110I ||| || BslFI ||| || |Hin6I ||| || ||GlaI ||| || |||HhaI Hin4I TfiI ||| || ||||HaeII | SspI HinfI Tsp4CI* SetI \\\ \\ \\\\\ \ \ \ \ \ CTGTACTCGAGCGCCCAGAAAATATTGCCCGATTCTAACCGTATTTTGAACCTTTCTTGG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GACATGAGCTCGCGGGTCTTTTATAACGGGCTAAGATTGGCATAAAACTTGGAAAGAACC /// ////// / / / / / ||| |||||| Hin4I SspI | Tsp4CI* SetI ||| |||||BslFI HinfI ||| ||||Hin6I TfiI ||| |||GlaI ||| ||HhaI ||| |PspXI ||| |HaeII ||| |SmlI ||| |XhoI ||| |AvaI ||| BmeT110I ||| TaqI ||TatI |Csp6I RsaI L Y S S A Q K I L P D S N R I L N L S W C T R A P R K Y C P I L T V F * T F L G V L E R P E N I A R F * P Y F E P F L A ----:----|----:----|----:----|----:----|----:----|----:----| R Y E L A W F I N G S E L R I K F R E Q G T S S R G S F I A R N * G Y K S G K K Q V R A G L F Y Q G I R V T N Q V K R P CviRI* | AciI TaqI | | MaeII | TspEI | | |BtrI | | MseI | | || SetI | | BccI | | || TaiI | | | AciI CviRI* \ \ \\ \ \ \ \ \ \ CGTTTGCATAACCGCACGTCTTTCCATCGAATTAACCGCATAATGCAACATTCTAACTCT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GCAAACGTATTGGCGTGCAGAAAGGTAGCTTAATTGGCGTATTACGTTGTAAGATTGAGA / // // / // / / CviRI* || |MaeII | || AciI CviRI* || BtrI | |MseI |TaiI | TspEI |SetI | BccI AciI TaqI R L H N R T S F H R I N R I M Q H S N S V C I T A R L S I E L T A * C N I L T L F A * P H V F P S N * P H N A T F * L Y ----:----|----:----|----:----|----:----|----:----|----:----| R K C L R V D K W R I L R M I C C E L E A N A Y G C T K G D F * G C L A V N * S T Q M V A R R E M S N V A Y H L M R V R MnlI | Cac8I | | AciI | | NspBII* | | |BisI | | ||BlsI | | |||TauI | | |||| Hpy166II | | |||| | AciI | | |||| | BisI | | |||| | |BlsI | | |||| | ||TauI | | |||| | ||NspBII* | | |||| | ||| Cac8I | | |||| | ||| |AsuI* | | |||| | ||| ||CviJI | | |||| | ||| ||HaeIII | | |||| | ||| ||BmgT120I | | |||| | ||| |||BssKI | | |||| | ||| |||SecI* | | |||| | ||| |||EcoRII | | |||| | ||| |||| ScrFI EciI AciI | | |||| | ||| |||| BseBI \ \ \ \ \\\\ \ \\\ \\\\ \ ATTATGGACTTCTCCGCCTCGCCCTTTGCCAGCGGCGTGAACGCCGCTGGCCCAGGCAAC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TAATACCTGAAGAGGCGGAGCGGGAAACGGTCGCCGCACTTGCGGCGACCGGGTCCGTTG / / / / /// / //// / /// /// EciI AciI | | ||BisI | |||| | ||| ||EcoRII | | ||AciI | |||| | ||| ||BssKI | | |BlsI | |||| | ||| |SecI* | | | | |||| | ||| BseBI | | | | |||| | ||| ScrFI | | | | |||| | ||AsuI* | | | | |||| | |BmgT120I | | | | |||| | HaeIII | | | | |||| | CviJI | | | | |||| Cac8I | | | | |||NspBII* | | | | |||AciI | | | | ||BisI | | | | |BlsI | | | | TauI | | | Hpy166II | | NspBII* | | TauI | Cac8I MnlI I M D F S A S P F A S G V N A A G P G N L W T S P P R P L P A A * T P L A Q A T Y G L L R L A L C Q R R E R R W P R Q Q ----:----|----:----|----:----|----:----|----:----|----:----| I I S K E A E G K A L P T F A A P G P L * * P S R R R A R Q W R R S R R Q G L C N H V E G G R G K G A A H V G S A W A V Hpy188I | FatI | |CviAII | || NlaIII TaqI MboII | || | SetI SetI MnlI | TspEI TsoI | || | MboII \ \ \ \ \ \ \\ \ \ AACGACCTCGATGACACCGATACTGATAACCAGCAATTCTTCCTTTCAGACATGAACCTC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCTGGAGCTACTGTGGCTATGACTATTGGTCGTTAAGAAGGAAAGTCTGTACTTGGAG / / / / / / / / /// / SetI TaqI MnlI MboII | TsoI | | ||| MboII TspEI | | ||SetI | | |FatI | | CviAII | NlaIII Hpy188I N D L D D T D T D N Q Q F F L S D M N L T T S M T P I L I T S N S S F Q T * T S R P R * H R Y * * P A I L P F R H E P Q ----:----|----:----|----:----|----:----|----:----|----:----| L S R S S V S V S L W C N K R E S M F R C R G R H C R Y Q Y G A I R G K L C S G V V E I V G I S I V L L E E K * V H V E MboI BplI XhoII BplI | DpnI | Esp3I | |MnlI | BsmAI | |BstKTI | |MaeII | |TspDTI | ||BtrI | || BinI* | ||| SetI | || | TspGWI Hpy99I | ||| TaiI \ \\ \ \ \ \ \\\ \ AACGGATCTTCTGTTTTTGAAAATGTGTTTGACGACGATGACGATGATGATGACGTGGAG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCCTAGAAGACAAAAACTTTTACACAAACTGCTGCTACTGCTACTACTACTGCACCTC // / / / / / / /// || | | TspGWI Hpy99I BplI | ||BsmAI || | BinI* BplI | ||Esp3I || XhoII | |MaeII || MboI | BtrI |MnlI TaiI |DpnI SetI TspDTI BstKTI N G S S V F E N V F D D D D D D D D V E T D L L F L K M C L T T M T M M M T W R R I F C F * K C V * R R * R * * * R G D ----:----|----:----|----:----|----:----|----:----|----:----| L P D E T K S F T N S S S S S S S S T S * R I K Q K Q F H T Q R R H R H H H R P V S R R N K F I H K V V I V I I I V H L BspCNI |BspMI HgaI |BseMII | ApaLI || FatI | | CviRI* || |CviAII | | Hpy166II || || NlaIII | | | SduI || || | Hin6I | | | BseSI || || | |GlaI | | | HgiAI* || || | |Eco47III | | | |DdeI || || | ||HhaI | | | || BplI || || | |||HaeII | | | || BplI || || | |||| BseYI | | | || Hpy188I || || | |||| | GsaI | | | || | SetI || || | |||| | | Cac8I \ \ \ \\ \ \ \\ \\ \ \\\\ \ \ \ ACGCACTCCATTGTGCACTCAGACCTGCTCAACGACATGGACAGCGCTTCCCAGCGTGCT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TGCGTGAGGTAACACGTGAGTCTGGACGAGTTGCTGTACCTGTCGCGAAGGGTCGCACGA ///// /// // // // //// / / / ||||| ||SetI || || || |||| | | Cac8I ||||| |DdeI || || || |||| | BseYI ||||| Hpy188I || || || |||| GsaI ||||ApaLI || || || |||Hin6I |||BplI || || || ||Eco47III |||BplI || || || ||GlaI ||Hpy166II || || || |HhaI ||CviRI* || || || HaeII |HgaI || || |FatI HgiAI* || || CviAII BseSI || |BspMI SduI || NlaIII |BseMII BspCNI T H S I V H S D L L N D M D S A S Q R A R T P L C T Q T C S T T W T A L P S V L A L H C A L R P A Q R H G Q R F P A C F ----:----|----:----|----:----|----:----|----:----|----:----| V C E M T C E S R S L S M S L A E W R A S A S W Q A S L G A * R C P C R K G A H R V G N H V * V Q E V V H V A S G L T S TaqI TspEI Hpy178III* | MnlI \ \ \ \ TCACATAATGCTTCTGGTTTCCCTAATTTTCTGGACACTTCCTGCTCGTCCTCCTTCGAT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| AGTGTATTACGAAGACCAAAGGGATTAAAAGACCTGTGAAGGACGAGCAGGAGGAAGCTA / / // | Hpy178III* |MnlI TspEI TaqI S H N A S G F P N F L D T S C S S S F D H I M L L V S L I F W T L P A R P P S M T * C F W F P * F S G H F L L V L L R * ----:----|----:----|----:----|----:----|----:----|----:----| E C L A E P K G L K R S V E Q E D E K S K V Y H K Q N G * N E P C K R S T R R R * M I S R T E R I K Q V S G A R G G E I Hin4II* MseI MseI | HphI |AhaIII* VspI \ \ \\ \ GACCACTTTATTTTCACCAATAACTTACCATTTTTAAATAATAATAGCATTAATAATAAT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CTGGTGAAATAAAAGTGGTTATTGAATGGTAAAAATTTATTATTATCGTAATTATTATTA / / // / | HphI |MseI VspI Hin4II* AhaIII* MseI D H F I F T N N L P F L N N N S I N N N T T L F S P I T Y H F * I I I A L I I I P L Y F H Q * L T I F K * * * H * * * S ----:----|----:----|----:----|----:----|----:----|----:----| S W K I K V L L K G N K F L L L M L L L H G S * K * W Y S V M K L Y Y Y C * Y Y V V K N E G I V * W K * I I I A N I I I Tsp4CI* | BseYI BslFI BtgZI | | GsaI SfaNI \ \ \ \ \ \ CATAGTCATAATAGTAGTCATAATAATAACAGTCCCAGCATCGCCAATAATACAAACGCA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GTATCAGTATTATCATCAGTATTATTATTGTCAGGGTCGTAGCGGTTATTATGTTTGCGT / / / / / / BslFI | | | BseYI SfaNI | | GsaI | Tsp4CI* BtgZI H S H N S S H N N N S P S I A N N T N A I V I I V V I I I T V P A S P I I Q T Q * S * * * S * * * Q S Q H R Q * Y K R K ----:----|----:----|----:----|----:----|----:----|----:----| * L * L L L * L L L L G L M A L L V F A D Y D Y Y Y D Y Y Y C D W C R W Y Y L R M T M I T T M I I V T G A D G I I C V C CviRI* | TstI | |TatI | ||Csp6I BseMII | |||RsaI |BspCNI DdeI TstI \ \\\\ \\ \ \ AACACAAACACAAACACAAGTGCAAGTACAAACACCAATAGTCCTTTACTGAGAAGAAAC 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTGTTTGTGTTTGTGTTCACGTTCATGTTTGTGGTTATCAGGAAATGACTCTTCTTTG / / /// // // | | ||TatI |BspCNI |DdeI | | |Csp6I BseMII TstI | | RsaI | CviRI* TstI N T N T N T S A S T N T N S P L L R R N T Q T Q T Q V Q V Q T P I V L Y * E E T H K H K H K C K Y K H Q * S F T E K K P ----:----|----:----|----:----|----:----|----:----|----:----| F V F V F V L A L V F V L L G K S L L F L C L C L C L H L Y L C W Y D K V S F F V C V C V C T C T C V G I T R * Q S S V BssKI CviJI EcoRII | ScrFI | BseBI | | CviJI | | |MwoI | | ||Cac8I | | |||Hpy178III* | | ||||NruI | | ||||FnuDII* | | ||||| TspGWI | | ||||| | ApoI | | ||||| | XmnI | | ||||| | TspEI | | ||||| | | MnlI | | ||||| | | | MboII SfeI* | | ||||| | | | |EcoNI |MnlI | | ||||| | | | || BsiYI* BdaI MboII || BccI | | ||||| | | | || | MnlI BdaI \ \\ \ \ \ \\\\\ \ \ \ \\ \ \ \ CCCTCCCCATCTATAGTGAAGCCTGGCTCGCGAAGAAATTCCTCCGTGAGGAAGAAGAAA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| GGGAGGGGTAGATATCACTTCGGACCGAGCGCTTCTTTAAGGAGGCACTCCTTCTTCTTT / / // / / / / // / / // / / / / MboII | |BccI | | | | || | | || | MnlI | SetI | SfeI* | | | | || | | || EcoNI BdaI MnlI | | | | || | | |BsiYI* BdaI | | | | || | | MboII | | | | || | TspEI | | | | || | ApoI | | | | || | MnlI | | | | || XmnI | | | | |Hpy178III* | | | | |TspGWI | | | | FnuDII* | | | | NruI | | | Cac8I | | EcoRII | | BssKI | | CviJI | BseBI | ScrFI | MwoI CviJI P S P S I V K P G S R R N S S V R K K K P P H L * * S L A R E E I P P * G R R N L P I Y S E A W L A K K F L R E E E E T ----:----|----:----|----:----|----:----|----:----|----:----| G E G D I T F G P E R L F E E T L F F F G R G M * L S A Q S A F F N R R S S S S G G W R Y H L R A R S S I G G H P L L F SetI MboII | MboII | | BspMI | | | MboI OliI | | | MboII MslI | | | BbvII* BdaI AloI | | | | DpnI BdaI AciI | | | | |BstKTI |MboII | FokI | | | | || MboII || CviRI* | | TaqI | | | | || | MboII || | EciI CviJI | | AsuII \ \ \ \ \\ \ \ \\ \ \ \ \ \ \ CCTGCTTTGAAGAAGATCAAGTCTTCCACTTCTGTGCAATCTTCGGCTACTCCGCCTTCG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| GGACGAAACTTCTTCTAGTTCAGAAGGTGAAGACACGTTAGAAGCCGATGAGGCGGAAGC / / / // / / / / / / / // / / / | MboII | || | | MboII | | | EciI |AloI | | AsuII MboII | || | MboII | | CviRI* CviJI | | TaqI | || BbvII* | MboII | FokI | || MboI | MslI AciI | |DpnI | OliI | BstKTI BdaI BspMI BdaI MboII P A L K K I K S S T S V Q S S A T P P S L L * R R S S L P L L C N L R L L R L R C F E E D Q V F H F C A I F G Y S A F E ----:----|----:----|----:----|----:----|----:----|----:----| G A K F F I L D E V E T C D E A V G G E V Q K S S S * T K W K Q A I K P * E A K R S Q L L D L R G S R H L R R S S R R R MnlI BetI* MnlI BspMII* |AciI |HpaII ||MnlI Hin4II* |Hpy178III* ||MmeI | SetI || BsgI MwoI |||NspBII* | BseGI || | AloI | CviRI* SetI |||| Hin4II* \ \ \\ \ \ \ \ \ \\\\ \ AACACCTCATCCAATCCGGATATAAAATGCTCCAACTGCACAACCTCCACCACTCCGCTG 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTGGAGTAGGTTAGGCCTATATTTTACGAGGTTGACGTGTTGGAGGTGGTGAGGCGAC /// / // / / / /// / / ||BseGI | |BspMII* MwoI | SetI ||| | Hin4II* |Hin4II* | |BetI* CviRI* ||| NspBII* SetI | |AloI ||| AciI | |BsgI ||MnlI | Hpy178III* |MmeI | HpaII MnlI MnlI N T S S N P D I K C S N C T T S T T P L T P H P I R I * N A P T A Q P P P L R C H L I Q S G Y K M L Q L H N L H H S A V ----:----|----:----|----:----|----:----|----:----|----:----| F V E D L G S I F H E L Q V V E V V G S S C R M W D P Y L I S W S C L R W W E A V G * G I R I Y F A G V A C G G G S R Q CviRI* | Bce83I* | |MwoI AsuI* | |BstAPI AvaII | ||MboII SmlI DraII | ||Cac8I Ksp632I* PpuMI | ||BsrDI | HgaI |BmgT120I | ||| AciI | |MnlI ||NlaIV | ||| |BisI | || AluI ||| MboII | ||| ||BlsI | || CviJI ||| BbvII* | ||| |||TauI | || | SetI ||| |StyI | ||| |||CviJI | || | |SecI* ||| |SecI* | ||| |||HaeIII | || | |DsaI* \\\ \\ \ \\\ \\\\ \ \\ \ \\ TGGAGGAAGGACCCCAAGGGTCTTCCCCTGTGCAATGCTTGCGGCCTCTTCCTCAAGCTC 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| ACCTCCTTCCTGGGGTTCCCAGAAGGGGACACGTTACGAACGCCGGAGAAGGAGTTCGAG // // / / /// //// //// // || |SecI* | | ||| |||HaeIII |||| |MnlI || |StyI | | ||| |||CviJI |||| HgaI || BbvII* | | ||| ||BisI |||CviJI |PpuMI | | ||| ||AciI |||AluI |DraII | | ||| |BlsI ||SmlI |AvaII | | ||| TauI |Ksp632I* |AsuI* | | ||Cac8I |SetI |MboII | | |MboII MnlI BmgT120I | | BsrDI NlaIV | Bce83I* | BstAPI | MwoI CviRI* W R K D P K G L P L C N A C G L F L K L G G R T P R V F P C A M L A A S S S S S E E G P Q G S S P V Q C L R P L P Q A P ----:----|----:----|----:----|----:----|----:----|----:----| H L F S G L P R G R H L A Q P R K R L S T S S P G W P D E G T C H K R G R G * A P P L V G L T K G Q A I S A A E E E L E BbvII* | MboII MnlI StuI | |Ksp632I* | AcyI CviJI | ||MseI PshAI | |MaeIII HaeIII | |||BsmAI | MboII | |Tsp45I | BceAI MnlI | |||| MnlI | |SetI \ \\ \ \ \ \ \\\\ \ \ \\ CACGGCGTCACAAGGCCTCTGTCGTTGAAGACTGACATCATTAAGAAGAGACAGAGGTCG 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| GTGCCGCAGTGTTCCGGAGACAGCAACTTCTGACTGTAGTAATTCTTCTCTGTCTCCAGC / / / / / / / / / / / | | | | | MnlI | | BsmAI | MboII | | | | BceAI | | MnlI PshAI | | | HaeIII | Ksp632I* SetI | | | CviJI | MseI | | | StuI BbvII* | | Tsp45I MboII | | MaeIII | AcyI DsaI* SecI* H G V T R P L S L K T D I I K K R Q R S T A S Q G L C R * R L T S L R R D R G R R R H K A S V V E D * H H * E E T E V V ----:----|----:----|----:----|----:----|----:----|----:----| W P T V L G R D N F V S M M L F L C L D G R R * L A E T T S S Q C * * S S V S T V A D C P R Q R Q L S V D N L L S L P R MnlI |BccI |Hpy99I || BsaXI || | BsmAI || | Esp3I || | | PfoI || | | BssKI || | | |HpaII || | | ||ScrFI || | | ||CauII* || | | ||| TseI AccI || | | ||| |BisI |Hpy166II BsaXI || | | ||| ||BlsI \\ \ \\ \ \ \\\ \\\ TCTACCAAGATAAACAACAATATAACGCCCCCTCCATCGTCGTCTCTCAATCCGGGAGCA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| AGATGGTTCTATTTGTTGTTATATTGCGGGGGAGGTAGCAGCAGAGAGTTAGGCCCTCGT // / / / // / / / // |AccI BsaXI | | |BccI | | | |BisI Hpy166II | | BsaXI | | | BlsI | MnlI | | BssKI Hpy99I | | PfoI | CauII* | HpaII | ScrFI Esp3I BsmAI S T K I N N N I T P P P S S S L N P G A L P R * T T I * R P L H R R L S I R E Q Y Q D K Q Q Y N A P S I V V S Q S G S S ----:----|----:----|----:----|----:----|----:----|----:----| D V L I F L L I V G G G D D D R L G P A T * W S L C C Y L A G E M T T E * D P L R G L Y V V I Y R G R W R R R E I R S C HgaI | EcoP15I | | MwoI | | | TseI | | | |BisI | | | ||BlsI BbvI | | | ||| MnlI BbvI MboII \ \ \ \ \\\ \ \ \ GCAGGGAAAAAGAAAAACTATACAGCAAGTGTGGCAGCGTCCAAGAGGAAGAACTCACTG 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CGTCCCTTTTTCTTTTTGATATGTCGTTCACACCGTCGCAGGTTCTCCTTCTTGAGTGAC / / / / /// / / / TseI BbvI | | ||TseI | TspRI MboII | | ||MnlI BbvI | | |BisI | | BlsI | EcoP15I | HgaI MwoI A G K K K N Y T A S V A A S K R K N S L Q G K R K T I Q Q V W Q R P R G R T H * R E K E K L Y S K C G S V Q E E E L T E ----:----|----:----|----:----|----:----|----:----|----:----| A P F F F F * V A L T A A D L L F F E S L L S F S F S Y L L H P L T W S S S S V C P F L F V I C C T H C R G L P L V * Q BspCNI MboII |BseMII | TstI || Hpy188I | BsaXI DdeI || | HphI | |SetI | Hpy178III* || | TstI | || BseGI TspRI SetI | |BsmAI || | | FokI | || |MnlI \ \ \ \\ \\ \ \ \ \ \\ \\ AACATTGTCGCACCTTTGAAGTCTCAGGACATACCCATTCCGAAGATTGCCTCACCTTCC 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTAACAGCGTGGAAACTTCAGAGTCCTGTATGGGTAAGGCTTCTAACGGAGTGGAAGG / // / // // / // / / / SetI || | || || HphI || | | MnlI || | || |Hpy188I || | BseGI || | || TstI || MboII || | |BseMII || BsaXI || | BspCNI || SetI || BsmAI |TstI |Hpy178III* FokI DdeI N I V A P L K S Q D I P I P K I A S P S T L S H L * S L R T Y P F R R L P H L P H C R T F E V S G H T H S E D C L T F H ----:----|----:----|----:----|----:----|----:----|----:----| F M T A G K F D * S M G M G F I A E G E S C Q R V K S T E P C V W E S S Q R V K V N D C R Q L R L V Y G N R L N G * R G SetI |AciI ||TstI |||BsrBI |||| MnlI TspGWI Csp6I TaqI Hin4II* |||| | BsaXI | SetI |RsaI |GsuI | BccI |||| | | TstI | | TaqI ||MnlI |Eco57MI \ \ \\\\ \ \ \ \ \ \ \\\ \\ ATCCCACAATACCTCCGCTCTAACACTCGCCACCACCTTTCGAGTTCCGTACCCATCGAG 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TAGGGTGTTATGGAGGCGAGATTGTGAGCGGTGGTGGAAAGCTCAAGGCATGGGTAGCTC / / // / / / / / // / / | | |TstI | | BsaXI TspGWI TaqI || | TaqI | | SetI | | TstI SetI || Eco57MI | BccI | MnlI || GsuI Hin4II* BsrBI |Csp6I AciI RsaI MnlI I P Q Y L R S N T R H H L S S S V P I E S H N T S A L T L A T T F R V P Y P S R P T I P P L * H S P P P F E F R T H R G ----:----|----:----|----:----|----:----|----:----|----:----| M G C Y R R E L V R W W R E L E T G M S W G V I G G S * C E G G G K S N R V W R D W L V E A R V S A V V K R T G Y G D L EciI |AluI TspDTI |CviJI |FatI AclI || SetI ||CviAII MaeII || |BsiYI* ||| NlaIII AciI | SetI || || CviJI ||| | SetI BccI | TaiI || || HaeIII ||| | | TspDTI \ \ \ \\ \\ \ \\\ \ \ \ GCGGAAACGTTCTCCAGCTTTCGGCCTGATATGAATATGACTATGAACATGAACCTTCAC 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CGCCTTTGCAAGAGGTCGAAAGCCGGACTATACTTATACTGATACTTGTACTTGGAAGTG // / / // / / / / /// / || | | || BsiYI* HaeIII | | ||| TspDTI || | | || CviJI CviJI | | ||SetI || | | || AluI | | |FatI || | | |SetI | | CviAII || | | EciI | NlaIII || | MaeII TspDTI || | AclI || TaiI || SetI |AciI BccI A E T F S S F R P D M N M T M N M N L H R K R S P A F G L I * I * L * T * T F T G N V L Q L S A * Y E Y D Y E H E P S Q ----:----|----:----|----:----|----:----|----:----|----:----| A S V N E L K R G S I F I V I F M F R * P P F T R W S E A Q Y S Y S * S C S G E R F R E G A K P R I H I H S H V H V K V MnlI | MnlI | | Hin4II* | | | CviJI | | | | Hpy178III* | | | | | TspDTI | | | | | |CviJI BseRI | | | | | |Hin4II* |TspDTI SetI | | | | | ||MlyI HinfI |Hin4II* | MnlI | | | | | ||PleI | AciI MboI \\ \ \ \ \ \ \ \ \\\ \ \ \ AACGCCTCAACCTCCTCCTTCAACAATGAAGCCTTCTGGAAGCCTTTGGACTCCGCAATA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCGGAGTTGGAGGAGGAAGTTGTTACTTCGGAAGACCTTCGGAAACCTGAGGCGTTAT /// / / / / / / // //// / / ||| SetI MnlI | | | CviJI || |||PleI | AciI ||Hin4II* | | Hin4II* || ||MlyI HinfI |TspDTI | MnlI || |CviJI BseRI MnlI || Hin4II* |TspDTI Hpy178III* N A S T S S F N N E A F W K P L D S A I T P Q P P P S T M K P S G S L W T P Q * R L N L L L Q Q * S L L E A F G L R N R ----:----|----:----|----:----|----:----|----:----|----:----| L A E V E E K L L S A K Q F G K S E A I C R R L R R R * C H L R R S A K P S R L V G * G G G E V I F G E P L R Q V G C Y GsuI DpnI Eco57MI |BstKTI | FatI BseMII || BsmAI | |CviAII TspDTI || | Hpy178III* | || NlaIII |BspCNI \\ \ \ \ \\ \ \\ GATCATCATTCTGGAGACACAAATCCAAACTCAAACATGAACACCACTCCAAATGGCAAT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGTAGTAAGACCTCTGTGTTTAGGTTTGAGTTTGTACTTGTGGTGAGGTTTACCGTTA // / // / / // // / || MboI |Hpy178III* | | |FatI |BspCNI MwoI |DpnI BsmAI | | CviAII TspDTI BstKTI | NlaIII BseMII Eco57MI GsuI D H H S G D T N P N S N M N T T P N G N I I I L E T Q I Q T Q T * T P L Q M A I S S F W R H K S K L K H E H H S K W Q S ----:----|----:----|----:----|----:----|----:----|----:----| S * * E P S V F G F E F M F V V G F P L L D D N Q L C L D L S L C S C W E L H C I M M R S V C I W V * V H V G S W I A I DdeI |MwoI |Hpy188I || BssKI TfiI || CviJI HinfI || EcoRII | Hpy188I || | ScrFI | |ApoI || | BseBI | |TspEI \\ \ \ \ \\ CTGAGCCTGGATTGGTTGAATCTGAATTTATAG 1510 1520 1530 ----:----|----:----|----:----|--- GACTCGGACCTAACCAACTTAGACTTAAATATC / // / / // / | || | EcoRII || TspEI | || | BssKI || ApoI | || BseBI |Hpy188I | || ScrFI HinfI | |CviJI TfiI | DdeI Hpy188I L S L D W L N L N L * * A W I G * I * I Y X E P G L V E S E F I X ----:----|----:----|----:----|--- R L R S Q N F R F K Y D S G P N T S D S N I Q A Q I P Q I Q I * L # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 12 BspACI,SsiI AclI 1 Psp1406I AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AhaIII* 2 DraI AloI 1 AluI 2 AluBI ApaLI 2 Alw44I,VneI ApoI 3 AcsI,XapI AsuI* 3 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BbvI 2 BseXI,BstV1I,Lsp1109I BbvII* 3 BpiI,BpuAI,BstV2I,BbsI BccI 5 Bce83I* 1 BpuEI BceAI 1 BdaI 2 BetI* 1 BsaWI BinI* 1 AlwI,BspPI,AclWI BisI 5 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 5 BmeT110I 1 BmgT120I 3 BplI 2 BsaXI 2 BseBI 3 Bst2UI,BstNI,BstOI,MvaI BseGI 2 BstF5I,BtsCI BseMII 4 BseRI 1 BseSI 2 BaeGI,BstSLI BseYI 2 BsgI 1 BsiYI* 3 Bsc4I,BseLI,BslI,AfiI BslFI 3 BsmFI,FaqI BsmAI 5 Alw26I,BstMAI Bsp1407I 1 BsrGI,BstAUI BspCNI 4 BspMI 2 BfuAI,Acc36I,BveI BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrBI 1 AccBSI,MbiI BsrDI 1 BseMI,Bse3DI BssKI 5 BstSCI,StyD4I BstAPI 1 BstKTI 3 BtgZI 2 BtrI 2 BmgBI,AjiI Cac8I 5 BstC8I CauII* 2 BcnI,BpuMI,NciI,AsuC2I Csp6I 4 CviQI,RsaNI CviAII 5 CviJI 12 CviKI-1 CviRI* 10 HpyCH4V DdeI 4 BstDEI,HpyF3I DpnI 3 MalI DraII 2 EcoO109I DsaI* 1 BtgI,BstDSI EciI 4 Eco47III 1 Aor51HI,AfeI Eco57MI 2 EcoNI 1 BstENI,XagI EcoP15I 1 EcoRII 3 AjnI,Psp6I,PspGI Esp3I 2 BsmBI FatI 5 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 2 GlaI 2 GsaI 2 GsuI 2 BpmI HaeII 2 BstH2I HaeIII 4 BsnI,BsuRI,BshFI,PhoI HgaI 3 CseI HgiAI* 3 Bbv12I,BsiHKAI,Alw21I HhaI 2 BstHHI,CfoI,AspLEI Hin4I 1 Hin4II* 8 HpyAV Hin6I 2 HinP1I,HspAI HinfI 4 HpaII 3 HapII,BsiSI,MspI HphI 2 AsuHPI Hpy166II 6 Hpy8I Hpy178III* 7 Hpy188III Hpy188I 5 Hpy99I 2 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeII 4 HpyCH4IV MaeIII 1 MboI 3 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 16 MlyI 2 SchI MmeI 1 MnlI 23 MseI 5 Tru1I,Tru9I MslI 3 RseI,SmiMI MwoI 5 HpyF10VI,BstMWI NlaIII 5 Hin1II,Hsp92II,FaeI NlaIV 2 BspLI,BmiI,PspN4I NruI 1 BtuMI,Bsp68I NspBII* 3 MspA1I NspI 1 BstNSI,XceI OliI 2 AleI PfoI 1 PleI 2 PpsI PpuMI 2 Psp5II,PspPPI PshAI 1 BstPAI,BoxI PspXI 1 RsaI 4 AfaI ScrFI 5 BmrFI,MspR9I,Bme1390I SduI 3 MhlI,Bsp1286I SecI* 3 BseDI,BssECI,BsaJI SetI 22 SfaNI 1 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 2 SmoI SspI 1 StuI 1 Eco147I,PceI,SseBI,AatI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 4 TaqI 8 TatI 3 TauI 3 TfiI 2 PfeI TseI 2 ApeKI TsoI 1 Tsp45I 1 NmuCI Tsp4CI* 4 HpyCH4III,TaaI,Bst4CI TspDTI 7 TspEI 6 TasI,Tsp509I,Sse9I TspGWI 3 TspRI 1 TscAI TstI 3 VspI 1 PshBI,AseI XhoI 1 Sfr274I,SlaI,StrI,TliI,PaeR7I XhoII 1 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AflII AflIII AgeI AjuI AlfI AlwNI ApaI AscI Asp718I AvrII BaeI BalI BamHI BarI BbvCI BcgI BciVI BclI BfiI BglI BglII BmtI Bpu10I BsaAI BsaBI BsePI BsiI* BsmI Bsp120I BspHI BspLU11I* BspOI BsrI BssNAI Bst1107I BstEII BstXI BstZ17I BtsI Cfr10I Cfr9I CfrI ClaI CspCI DinI DraIII DrdI Eam1105I Ecl136II Eco31I Eco57I EcoICRI EcoRI EcoRV EcoT22I EgeI EheI EspI* FalI FauI FseI FspAI HgiCI* HgiJII* HindII HindIII HpaI KasI KpnI MaeI MauBI McrI* MfeI MluI Mph1103I MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NsiI PacI PasI PflMI PmaCI PmeI PpiI PsiI PspOMI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SwaI TaqII TspMI Tth111I XbaI XcmI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769