Restriction Map of HOM3/YER052C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

HOM3/YER052C on chromosome V from coordinates 257958 to 256375.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.12827

EMBOSS_001 TaqI AsuII BfiI | MmeI CviRI* SetI | | BsrI | BaeI \ \ \ \ \ \ ATGCCAATGGATTTCCAACCTACATCAAGTCATTCGAACTGGGTCGTGCAAAAGTTCGGT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGGTTACCTAAAGGTTGGATGTAGTTCAGTAAGCTTGACCCAGCACGTTTTCAAGCCA / // / // SetI || BsrI |CviRI* |MmeI |BaeI AsuII BfiI TaqI M P M D F Q P T S S H S N W V V Q K F G C Q W I S N L H Q V I R T G S C K S S V A N G F P T Y I K S F E L G R A K V R W ----:----|----:----|----:----|----:----|----:----|----:----| X G I S K W G V D L * E F Q T T C F N P X A L P N G V * M L D N S S P R A F T R H W H I E L R C * T M R V P D H L L E T Csp6I ApoI PflMI |RsaI TspEI BaeI BsiYI* BseGI FokI \\ \ \ \ \ \ GGTACATCTGTCGGTAAATTTCCCGTCCAAATAGTGGATGACATTGTGAAGCACTATTCT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CCATGTAGACAGCCATTTAAAGGGCAGGTTTATCACCTACTGTAACACTTCGTGATAAGA // // / / / |Csp6I |BaeI BsiYI* BseGI FokI RsaI TspEI PflMI ApoI G T S V G K F P V Q I V D D I V K H Y S V H L S V N F P S K * W M T L * S T I L Y I C R * I S R P N S G * H C E A L F * ----:----|----:----|----:----|----:----|----:----|----:----| P V D T P L N G T W I T S S M T F C * E H Y M Q R Y I E R G F L P H C Q S A S N T C R D T F K G D L Y H I V N H L V I R SetI | AsuI* | |CviJI AciI | |HaeIII MboII StyI | |BmgT120I BceAI EciI TspDTI SecI* \ \\ \ \ \ \ AAACCTGACGGCCCAAACAATAATGTCGCTGTCGTTTGTTCCGCCCGTTCTTCATACACC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGGACTGCCGGGTTTGTTATTACAGCGACAGCAAACAAGGCGGGCAAGAAGTATGTGG / /// / / // / / SetI ||AsuI* | EciI || AciI Hin4II* |BmgT120I BceAI |MboII HaeIII TspDTI CviJI K P D G P N N N V A V V C S A R S S Y T N L T A Q T I M S L S F V P P V L H T P T * R P K Q * C R C R L F R P F F I H Q ----:----|----:----|----:----|----:----|----:----|----:----| L G S P G F L L T A T T Q E A R E E Y V * V Q R G L C Y H R Q R K N R G N K M C F R V A W V I I D S D N T G G T R * V G Acc65I HgiCI* |Csp6I ||RsaI ||SetI TfiI Hin4II* ||NlaIV Eco57I HinfI | CviJI ||| KpnI Eco57MI CviJI | Hpy188I \ \ \\\ \ \ \ \ \ AAGGCTGAAGGTACCACTTCTCGTCTTTTGAAATGTTGTGATTTGGCTTCGCAAGAATCT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCGACTTCCATGGTGAAGAGCAGAAAACTTTACAACACTAAACCGAAGCGTTCTTAGA // / / /// / / // || | | ||HgiCI* Eco57MI CviJI |Hpy188I || | | ||Acc65I Eco57I HinfI || | | |Csp6I TfiI || | | NlaIV || | | RsaI || | KpnI || SetI |CviJI SecI* StyI K A E G T T S R L L K C C D L A S Q E S R L K V P L L V F * N V V I W L R K N L G * R Y H F S S F E M L * F G F A R I * ----:----|----:----|----:----|----:----|----:----|----:----| L A S P V V E R R K F H Q S K A E C S D W P Q L Y W K E D K S I N H N P K A L I L S F T G S R T K Q F T T I Q S R L F R TspDTI ApoI Hpy178III* TaqI | AciI TspEI | TaqI Hpy188I ClaI | McrI* \ \ \ \ \ \ \ GAATTTCAAGACATTATCGAAGTTATCAGACAAGACCATATCGATAATGCCGACCGCTTC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAAAGTTCTGTAATAGCTTCAATAGTCTGTTCTGGTATAGCTATTACGGCTGGCGAAG / / / / / / / / | | TaqI Hpy188I | | | AciI | Hpy178III* | | McrI* TspEI | TspDTI ApoI ClaI TaqI E F Q D I I E V I R Q D H I D N A D R F N F K T L S K L S D K T I S I M P T A S I S R H Y R S Y Q T R P Y R * C R P L H ----:----|----:----|----:----|----:----|----:----|----:----| S N * S M I S T I L C S W I S L A S R K Q I E L C * R L * * V L G Y R Y H R G S F K L V N D F N D S L V M D I I G V A E CviRI* |MwoI ||Cac8I ||| CviJI BstXI BseGI FokI \\\ \ \ \ \ ATTCTCAATCCTGCCTTGCAAGCCAAGTTAGTGGATGATACCAATAAAGAACTTGAACTG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGAGTTAGGACGGAACGTTCGGTTCAATCACCTACTATGGTTATTTCTTGAACTTGAC / / / / / / / / | | | | BstXI BseGI FokI BsrI | | | CviJI | | Cac8I | CviRI* MwoI I L N P A L Q A K L V D D T N K E L E L F S I L P C K P S * W M I P I K N L N W S Q S C L A S Q V S G * Y Q * R T * T G ----:----|----:----|----:----|----:----|----:----|----:----| M R L G A K C A L N T S S V L L S S S S * E * D Q R A L W T L P H Y W Y L V Q V N E I R G Q L G L * H I I G I F F K F Q HphI Hpy166II | MaeII | |BsaAI | ||Csp6I | |||RsaI | |||SetI | |||TaiI BsrI | |||| Tsp4CI* |Hpy178III* | |||| | MboI || SspI | |||| | BglII || | MseI | |||| | XhoII || | |SwaI | |||| | | DpnI || | |AhaIII* TaqII | |||| | | |BstKTI \\ \ \\ \ \ \\\\ \ \ \\ GTCAAGAAATATTTAAATGCTTCAAAAGTTTTGGGTGAAGTGAGTTCACGTACAGTAGAT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTTCTTTATAAATTTACGAAGTTTTCAAAACCCACTTCACTCAAGTGCATGTCATCTA / / // / /// ///// // | | |MseI TaqII ||| ||||| |DpnI | | AhaIII* ||| ||||| BstKTI | | SwaI ||| ||||Tsp4CI* | SspI ||| |||Csp6I Hpy178III* ||| ||RsaI ||| |MaeII ||| BsaAI ||TaiI ||SetI |Hpy166II HphI V K K Y L N A S K V L G E V S S R T V D S R N I * M L Q K F W V K * V H V Q * I Q E I F K C F K S F G * S E F T Y S R S ----:----|----:----|----:----|----:----|----:----|----:----| T L F Y K F A E F T K P S T L E R V T S P * S I N L H K L L K P H L S N V Y L L D L F I * I S * F N Q T F H T * T C Y I FatI FatI BspHI |CviAII |CviAII || NlaIII TspDTI |Hpy178III* SecI* || |HphI |HphI || NlaIII DsaI* \\ \\ \\ \\ \ \ CTGGTGATGTCATGTGGTGAGAAGTTGAGTTGTTTGTTCATGACTGCTTTATGTAATGAC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GACCACTACAGTACACCACTCTTCAACTCAACAAACAAGTACTGACGAAATACATTACTG / / // / / / // / XhoII | |HphI | HphI | |BspHI Tsp4CI* BglII | |FatI TspDTI | |FatI MboI | CviAII | Hpy178III* NlaIII | CviAII NlaIII L V M S C G E K L S C L F M T A L C N D W * C H V V R S * V V C S * L L Y V M T G D V M W * E V E L F V H D C F M * * P ----:----|----:----|----:----|----:----|----:----|----:----| R T I D H P S F N L Q K N M V A K H L S D P S T M H H S T S N N T * S Q K I Y H Q H H * T T L L Q T T Q E H S S * T I V Tsp4CI* CviJI Hpy188I Cac8I | CviJI HaeIII BstXI CviJI | MnlI TspRI \ \ \ \ \ \ \ \ CGTGGCTGTAAGGCCAAATATGTGGATTTGAGCCACATTGTTCCCTCTGATTTCAGTGCC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GCACCGACATTCCGGTTTATACACCTAAACTCGGTGTAACAAGGGAGACTAAAGTCACGG // / / / / / / / |CviJI | BstXI CviJI | | MnlI Cac8I DsaI* HaeIII | TspRI SecI* CviJI Hpy188I R G C K A K Y V D L S H I V P S D F S A V A V R P N M W I * A T L F P L I S V P W L * G Q I C G F E P H C S L * F Q C Q ----:----|----:----|----:----|----:----|----:----|----:----| R P Q L A L Y T S K L W M T G E S K L A G H S Y P W I H P N S G C Q E R Q N * H T A T L G F I H I Q A V N N G R I E T G Hin6I TspEI |GlaI | AsuI* |Eco47III BssKI | |CviJI ||HhaI EcoRII | |HaeIII |||HaeII | ScrFI | |BmgT120I ||||BstXI Tsp4CI* | BseBI AjuI | ||NlaIV \\\\\ \ \ \ \ \ \\\ AGCGCTTTGGATAACAGTTTCTACACTTTCCTGGTTCAAGCATTGAAAGAAAAATTGGCC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TCGCGAAACCTATTGTCAAAGATGTGAAAGGACCAAGTTCGTAACTTTCTTTTTAACCGG //// / / / / /// |||Hin6I Tsp4CI* | EcoRII | ||AsuI* ||Eco47III | BssKI | |BmgT120I ||GlaI BseBI | |NlaIV |BstXI ScrFI | HaeIII |HhaI AjuI | CviJI HaeII TspEI S A L D N S F Y T F L V Q A L K E K L A A L W I T V S T L S W F K H * K K N W P R F G * Q F L H F P G S S I E R K I G P ----:----|----:----|----:----|----:----|----:----|----:----| L A K S L L K * V K R T * A N F S F N A W R K P Y C N R C K G P E L M S L F I P A S Q I V T E V S E Q N L C Q F F F Q G AjuI BsrI \ \ CCCTTTGTAAGTGCTAAAGAGCGTATCGTTCCAGTCTTTACAGGGTTTTTTGGTTTAGTT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| GGGAAACATTCACGATTTCTCGCATAGCAAGGTCAGAAATGTCCCAAAAAACCAAATCAA / / / AjuI BsrI MboII P F V S A K E R I V P V F T G F F G L V P L * V L K S V S F Q S L Q G F L V * F L C K C * R A Y R S S L Y R V F W F S S ----:----|----:----|----:----|----:----|----:----|----:----| G K T L A L S R I T G T K V P N K P K T G R Q L H * L A Y R E L R * L T K Q N L G K Y T S F L T D N W D K C P K K T * N AciI MmeI BisI MboII Hpy188I | BcgI |BlsI BbvII* BsrI | TsoI | | CviJI ||TauI MwoI \ \ \ \ \ \ \ \\\ \ CCAACTGGTCTTCTGAATGGTGTTGGTCGTGGCTATACCGATTTATGTGCCGCTTTGATA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTGACCAGAAGACTTACCACAACCAGCACCGATATGGCTAAATACACGGCGAAACTAT / / / / / / / //// / / | BsrI | TsoI | BcgI CviJI |||| MwoI BcgI BbvII* Hpy188I MmeI |||AciI ||BisI |BlsI TauI P T G L L N G V G R G Y T D L C A A L I Q L V F * M V L V V A I P I Y V P L * * N W S S E W C W S W L Y R F M C R F D S ----:----|----:----|----:----|----:----|----:----|----:----| G V P R R F P T P R P * V S K H A A K I E L Q D E S H H Q D H S Y R N I H R K S W S T K Q I T N T T A I G I * T G S Q Y Hin4II* |EcoP15I || TspDTI BcgI AlwNI MwoI || | BccI BinI* \ \ \ \\ \ \ \ GCAGTTGCTGTAAATGCTGATGAACTACAAGTTTGGAAGGAAGTTGATGGTATATTTACT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CGTCAACGACATTTACGACTACTTGATGTTCAAACCTTCCTTCAACTACCATATAAATGA / / / / / / AlwNI MwoI | EcoP15I BccI BinI* | TspDTI Hin4II* A V A V N A D E L Q V W K E V D G I F T Q L L * M L M N Y K F G R K L M V Y L L S C C K C * * T T S L E G S * W Y I Y C ----:----|----:----|----:----|----:----|----:----|----:----| A T A T F A S S S C T Q F S T S P I N V L L Q Q L H Q H V V L K S P L Q H Y I * C N S Y I S I F * L N P L F N I T Y K S SetI Tsp4CI* MnlI |Eco57I NlaIV |Eco57MI | Hpy178III* ||MaeIII | | MaeII ||| TspRI | | | SetI ||| | Hpy178III* | | | TaiI ||| | | HindIII MboI | | | | GsuI ||| | | | AluI | DpnI | | | | Eco57MI ||| | | | CviJI | |BstKTI | | | | | MaeI ||| | | | | SetI \ \\ \ \ \ \ \ \ \\\ \ \ \ \ \ GCTGATCCTCGTAAGGTTCCTGAAGCACGTTTGCTAGACAGTGTTACTCCAGAAGAAGCT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CGACTAGGAGCATTCCAAGGACTTCGTGCAAACGATCTGTCACAATGAGGTCTTCTTCGA // / / // / / // / / / / / / / || MboI | || | | || | Eco57MI | | | | HindIII |DpnI | || | | || | Tsp4CI* | | | CviJI BstKTI | || | | || | Eco57I | | | AluI | || | | || TspRI | | SetI | || | | || MaeI | Hpy178III* | || | | |Eco57MI MaeIII | || | | |GsuI | || | | MaeII | || | TaiI | || | SetI | || Hpy178III* | |NlaIV | MnlI SetI A D P R K V P E A R L L D S V T P E E A L I L V R F L K H V C * T V L L Q K K L * S S * G S * S T F A R Q C Y S R R S F ----:----|----:----|----:----|----:----|----:----|----:----| A S G R L T G S A R K S S L T V G S S A Q Q D E Y P E Q L V N A L C H * E L L L S I R T L N R F C T Q * V T N S W F F S Hpy188I |TspEI FokI |MboII |NlaIV || MseI || Hpy188I BseGI BccI \\ \ \\ \ \ \ TCTGAATTAACATATTATGGTTCCGAAGTTATACATCCTTTTACGATGGAACAAGTTATT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| AGACTTAATTGTATAATACCAAGGCTTCAATATGTAGGAAAATGCTACCTTGTTCAATAA // // / // / / || |MseI | |FokI BseGI BccI || TspEI | Hpy188I |MboII NlaIV Hpy188I S E L T Y Y G S E V I H P F T M E Q V I L N * H I M V P K L Y I L L R W N K L L * I N I L W F R S Y T S F Y D G T S Y * ----:----|----:----|----:----|----:----|----:----|----:----| E S N V Y * P E S T I C G K V I S C T I K Q I L M N H N R L * V D K * S P V L * R F * C I I T G F N Y M R K R H F L N N MaeIII | SetI | | Acc65I | | HgiCI* | | Tsp4CI* CviJI | | |Csp6I |DdeI TfiI | | ||RsaI || TfiI HinfI | | ||NlaIV || HinfI | Hpy178III* | | ||| KpnI \\ \ \ \ \ \ \\\ \ AGGGCTAAGATTCCTATTAGAATCAAGAATGTTCAAAATCCATTAGGTAACGGTACCATT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TCCCGATTCTAAGGATAATCTTAGTTCTTACAAGTTTTAGGTAATCCATTGCCATGGTAA / / / / / / // /// | | HinfI | Hpy178III* SetI || ||HgiCI* | | TfiI HinfI || ||Acc65I | DdeI TfiI || |Csp6I CviJI || NlaIV || RsaI |KpnI Tsp4CI* MaeIII R A K I P I R I K N V Q N P L G N G T I G L R F L L E S R M F K I H * V T V P L G * D S Y * N Q E C S K S I R * R Y H Y ----:----|----:----|----:----|----:----|----:----|----:----| L A L I G I L I L F T * F G N P L P V M * P * S E * * F * S H E F D M L Y R Y W P S L N R N S D L I N L I W * T V T G N HphI | BseMII | |BseGI | |BspCNI | ||Hin4I TfiI | ||| PpiI HinfI | ||| | Hpy178III* Hin4II* |FokI | ||| | |DdeI MnlI \ \\ \ \\\ \ \\ \ ATCTACCCAGATAATGTAGCAAAGAAGGGTGAATCTACTCCACCACATCCTCCTGAGAAC 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TAGATGGGTCTATTACATCGTTTCTTCCCACTTAGATGAGGTGGTGTAGGAGGACTCTTG / / / / //// / / / Hin4II* | | | |||PpiI | | MnlI | | | ||BspCNI | DdeI | | | ||BseGI Hpy178III* | | | |BseMII | | | Hin4I | | HphI | FokI HinfI TfiI I Y P D N V A K K G E S T P P H P P E N S T Q I M * Q R R V N L L H H I L L R T L P R * C S K E G * I Y S T T S S * E L ----:----|----:----|----:----|----:----|----:----|----:----| I * G S L T A F F P S D V G G C G G S F * R G L Y H L L S P H I * E V V D E Q S D V W I I Y C L L T F R S W W M R R L V TspDTI | HgiCI* MnlI | | SetI | Hin4I | | NlaIV | | PpiI | | | BtsI | | | MnlI | | | |HphI TspRI \ \ \ \ \ \ \ \\ \ TTATCCTCATCTTTCTATGAAAAGAGAAAGAGAGGTGCCACTGCTATCACCACCAAAAAT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| AATAGGAGTAGAAAGATACTTTTCTCTTTCTCTCCACGGTGACGATAGTGGTGGTTTTTA // / / / / / / || PpiI MnlI | | | HgiCI* |MnlI | | | HphI Hin4I | | NlaIV | | TspRI | | BtsI | SetI TspDTI L S S S F Y E K R K R G A T A I T T K N Y P H L S M K R E R E V P L L S P P K M I L I F L * K E K E R C H C Y H H Q K * ----:----|----:----|----:----|----:----|----:----|----:----| K D E D K * S F L F L P A V A I V V L F S I R M K R H F S F S L H W Q * * W W F * G * R E I F L S L S T G S S D G G F I FatI NcoI StyI SecI* DsaI* |CviAII || NlaIII || | MaeI || | | FokI || | | AluI DrdI || | | CviJI | TspDTI || | | | SetI \ \ \\ \ \ \ \ GACATTTTCGTCATCAACATTCATTCCAATAAGAAAACCCTATCCCATGGTTTCCTAGCT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTAAAAGCAGTAGTTGTAAGTAAGGTTATTCTTTTGGGATAGGGTACCAAAGGATCGA / / / // /// | TspDTI | |DsaI* ||CviJI DrdI | |SecI* ||AluI | |StyI |MaeI | |NcoI SetI | |FatI | CviAII NlaIII D I F V I N I H S N K K T L S H G F L A T F S S S T F I P I R K P Y P M V S * L H F R H Q H S F Q * E N P I P W F P S S ----:----|----:----|----:----|----:----|----:----|----:----| S M K T M L M * E L L F V R D W P K R A H C K R * * C E N W Y S F G I G H N G L V N E D D V N M G I L F G * G M T E * S BseGI | PfoI | BssKI | EcoRII | | ScrFI | | BseBI | | | BccI | | | | TatI TspDTI | | | | |Csp6I Hin4I | Hpy188I SspI | | | | ||RsaI Hin4I MseI | | BcgI \ \ \ \ \ \\\ \ \ \ \ \ CAAATATTTACCATCCTGGATAAGTACAAGTTAGTCGTAGATTTAATATCTACTTCTGAA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTATAAATGGTAGGACCTATTCATGTTCAATCAGCATCTAAATTATAGATGAAGACTT / / / / // /// / / / / | | BseGI | |BccI ||TatI MseI | | Hin4I | SspI | | |Csp6I | | Hin4I FokI | | |Hin4I | | BcgI | | |Hin4I | Hpy188I | | RsaI TspDTI | EcoRII | BssKI | PfoI BseBI ScrFI Q I F T I L D K Y K L V V D L I S T S E K Y L P S W I S T S * S * I * Y L L L K N I Y H P G * V Q V S R R F N I Y F * S ----:----|----:----|----:----|----:----|----:----|----:----| * I N V M R S L Y L N T T S K I D V E S E F I * W G P Y T C T L R L N L I * K Q L Y K G D Q I L V L * D Y I * Y R S R F MseI BseMII |BspCNI FatI || BsmAI Hin4I Hpy178III* || | DdeI Hin4I CviJI | MlyI || | |BseMII |CviAII |Eco57I | PleI || | |Hpy188I || BccI |Eco57MI | | BcgI || | ||Hin4I || |NlaIII || SfaNI | | CviRI* || | ||BspCNI || || TaqI || |Hin4I | | | HinfI || | ||| MnlI \\ \\ \ \\ \\ \ \ \ \ \\ \ \\\ \ GTTCATGTTTCGATGGCTTTGCCCATTCCAGATGCAGACTCATTAAAATCTCTGAGACAA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CAAGTACAAAGCTACCGAAACGGGTAAGGTCTACGTCTGAGTAATTTTAGAGACTCTGTT / // / /// / /// / /// / / // // / | |FatI | ||Hin4I | ||| | ||| | | || || SetI | |BccI | |CviJI | ||| | ||| | | || |MnlI | | | Eco57MI | ||| | ||| | | || DdeI | | | Eco57I | ||| | ||| | | |Hpy188I | | TaqI | ||| | ||| | | |BspCNI | CviAII | ||| | ||| | | |BsmAI NlaIII | ||| | ||| | | BseMII | ||| | ||| | Hin4I | ||| | ||| MseI | ||| | ||BspCNI | ||| | |BseMII | ||| | HinfI | ||| CviRI* | ||BcgI | ||PleI | |MlyI | Hpy178III* SfaNI V H V S M A L P I P D A D S L K S L R Q F M F R W L C P F Q M Q T H * N L * D K S C F D G F A H S R C R L I K I S E T S ----:----|----:----|----:----|----:----|----:----|----:----| T * T E I A K G M G S A S E N F D R L C L E H K S P K A W E L H L S M L I E S V N M N R H S Q G N W I C V * * F R Q S L AluI CviJI |DdeI |BbvCI |Bpu10I ApoI ||SetI TspEI TspEI SetI EcoRV TspDTI \\\ \ \ \ \ \ GCTGAGGAAAAATTGAGAATTTTAGGTTCTGTTGATATCACAAAGAAGTTGTCTATTGTT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CGACTCCTTTTTAACTCTTAAAATCCAAGACAACTATAGTGTTTCTTCAACAGATAACAA / / / / / / / | Bpu10I TspEI | SetI EcoRV TspDTI | BbvCI TspEI | DdeI ApoI CviJI AluI A E E K L R I L G S V D I T K K L S I V L R K N * E F * V L L I S Q R S C L L F * G K I E N F R F C * Y H K E V V Y C F ----:----|----:----|----:----|----:----|----:----|----:----| A S S F N L I K P E T S I V F F N D I T L Q P F I S F K L N Q Q Y * L S T T * Q S L F F Q S N * T R N I D C L L Q R N N Acc65I HgiCI* |Csp6I ||RsaI ||NlaIV ||| FatI ||| KpnI ||| |CviAII Hpy166II TspDTI ||| || NlaIII | NdeI |BsrDI ||| || | Hpy166II \ \ \\ \\\ \\ \ \ TCATTAGTTGGTAAACATATGAAACAATACATCGGCATTGCTGGTACCATGTTTACTACT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| AGTAATCAACCATTTGTATACTTTGTTATGTAGCCGTAACGACCATGGTACAAATGATGA / / // / /// // / | NdeI |BsrDI | ||| || Hpy166II Hpy166II TspDTI | ||| |FatI | ||| CviAII | ||HgiCI* | ||Acc65I | ||NlaIII | |Csp6I | NlaIV | RsaI KpnI S L V G K H M K Q Y I G I A G T M F T T H * L V N I * N N T S A L L V P C L L L I S W * T Y E T I H R H C W Y H V Y Y S ----:----|----:----|----:----|----:----|----:----|----:----| E N T P L C I F C Y M P M A P V M N V V K M L Q Y V Y S V I C R C Q Q Y W T * * * * N T F M H F L V D A N S T G H K S S MboII |Bce83I* || SfaNI || | MslI || | |Eco57I Hin4II* || | |Eco57MI SmlI \ \\ \ \\ \ CTTGCTGAAGAAGGCATCAACATTGAAATGATTTCTCAAGGGGCAAATGAAATAAACATA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| GAACGACTTCTTCCGTAGTTGTAACTTTACTAAAGAGTTCCCCGTTTACTTTATTTGTAT / / // / / / Hin4II* | || SfaNI SmlI TspDTI | |MslI | Eco57MI | Eco57I Bce83I* MboII L A E E G I N I E M I S Q G A N E I N I L L K K A S T L K * F L K G Q M K * T Y C * R R H Q H * N D F S R G K * N K H I ----:----|----:----|----:----|----:----|----:----|----:----| R A S S P M L M S I I E * P A F S I F M E Q Q L L C * C Q F S K E L P L H F L C K S F F A D V N F H N R L P C I F Y V Y TspDTI MlyI | Hin6I PleI | |GlaI TfiI | |Eco47III FatI HinfI | ||HhaI |CviAII | Hpy188I | |||HaeII || NlaIII TspDTI | |HinfI | |||TspDTI || | MaeIII \ \ \\ \ \\\\ \\ \ \ TCCTGCGTTATCAATGAATCTGACTCCATAAAAGCGCTACAATGTATTCATGCCAAGTTA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| AGGACGCAATAGTTACTTAGACTGAGGTATTTTCGCGATGTTACATAAGTACGGTTCAAT // // / / //// / // || || | | |||Hin6I | |FatI || || | | ||Eco47III | CviAII || || | | ||TspDTI NlaIII || || | | ||GlaI || || | | |HhaI || || | | HaeII || || | TspDTI || || HinfI || |Hpy188I || HinfI || TfiI |PleI MlyI S C V I N E S D S I K A L Q C I H A K L P A L S M N L T P * K R Y N V F M P S Y L R Y Q * I * L H K S A T M Y S C Q V T ----:----|----:----|----:----|----:----|----:----|----:----| D Q T I L S D S E M F A S C H I * A L N I R R * * H I Q S W L L A V I Y E H W T G A N D I F R V G Y F R * L T N M G L * FatI AclI |CviAII MaeII AciI || NspI | SetI DdeI BsrBI TspEI || NlaIII | TaiI \ \ \ \\ \ \ \ CTAAGTGAGCGGACAAATACTTCAAACCAATTTGAACATGCCATTGATGAACGTTTAGAA 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| GATTCACTCGCCTGTTTATGAAGTTTGGTTAAACTTGTACGGTAACTACTTGCAAATCTT / / / / / / // / / / | DdeI | AciI | | |FatI | MaeII TspDTI MaeIII BsrBI | | CviAII | AclI | NlaIII TaiI | NspI SetI TspEI L S E R T N T S N Q F E H A I D E R L E * V S G Q I L Q T N L N M P L M N V * N K * A D K Y F K P I * T C H * * T F R T ----:----|----:----|----:----|----:----|----:----|----:----| S L S R V F V E F W N S C A M S S R K S V L H A S L Y K L G I Q V H W Q H V N L * T L P C I S * V L K F M G N I F T * F MfeI ApoI TspEI TspEI |TspDTI | MseI \\ \ \ CAATTGAAAAGACTTGGAATTTAA 1570 1580 ----:----|----:----|---- GTTAACTTTTCTGAACCTTAAATT / / / TspEI | MseI MfeI TspEI ApoI Q L K R L G I * N * K D L E F X I E K T W N L X ----:----|----:----|---- C N F L S P I * V I S F V Q F K L Q F S K S N L # Enzymes that cut Frequency Isoschizomers Acc65I 3 Asp718I AciI 4 BspACI,SsiI AclI 1 Psp1406I AhaIII* 1 DraI AjuI 1 AluI 3 AluBI AlwNI 1 CaiI ApoI 4 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI BaeI 1 BbvCI 1 BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 4 Bce83I* 1 BpuEI BceAI 1 BcgI 2 BfiI 1 BmrI,BmuI BglII 1 BinI* 1 AlwI,BspPI,AclWI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmgT120I 2 Bpu10I 1 BsaAI 1 BstBAI,Ppu21I BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 5 BstF5I,BtsCI BseMII 3 BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BsmAI 1 Alw26I,BstMAI BspCNI 3 BspHI 1 CciI,PagI,RcaI BsrBI 1 AccBSI,MbiI BsrDI 1 BseMI,Bse3DI BsrI 4 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BstKTI 2 BstXI 3 BtsI 1 Cac8I 2 BstC8I ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 6 CviQI,RsaNI CviAII 7 CviJI 14 CviKI-1 CviRI* 3 HpyCH4V DdeI 5 BstDEI,HpyF3I DpnI 2 MalI DrdI 1 AasI,DseDI DsaI* 2 BtgI,BstDSI EciI 1 Eco47III 2 Aor51HI,AfeI Eco57I 4 AcuI Eco57MI 5 EcoP15I 1 EcoRII 2 AjnI,Psp6I,PspGI EcoRV 1 Eco32I FatI 7 FokI 5 GlaI 2 GsuI 1 BpmI HaeII 2 BstH2I HaeIII 3 BsnI,BsuRI,BshFI,PhoI HgiCI* 4 BanI,BshNI,BspT107I,AccB1I HhaI 2 BstHHI,CfoI,AspLEI Hin4I 4 Hin4II* 4 HpyAV Hin6I 2 HinP1I,HspAI HindIII 1 HinfI 7 HphI 5 AsuHPI Hpy166II 3 Hpy8I Hpy178III* 8 Hpy188III Hpy188I 9 KpnI 3 MaeI 2 FspBI,BfaI,XspI MaeII 3 HpyCH4IV MaeIII 3 MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 4 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 1 MunI MlyI 2 SchI MmeI 2 MnlI 6 MseI 5 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 3 HpyF10VI,BstMWI NcoI 1 Bsp19I NdeI 1 FauNDI NlaIII 7 Hin1II,Hsp92II,FaeI NlaIV 7 BspLI,BmiI,PspN4I NspI 1 BstNSI,XceI PflMI 1 BasI,AccB7I,Van91I PfoI 1 PleI 2 PpsI PpiI 1 RsaI 6 AfaI ScrFI 2 BmrFI,MspR9I,Bme1390I SecI* 3 BseDI,BssECI,BsaJI SetI 13 SfaNI 2 LweI SmlI 1 SmoI SspI 2 StyI 2 Eco130I,EcoT14I,ErhI,BssT1I SwaI 1 SmiI TaiI 3 TaqI 4 TaqII 1 TatI 1 TauI 1 TfiI 5 PfeI TsoI 1 Tsp4CI* 5 HpyCH4III,TaaI,Bst4CI TspDTI 13 TspEI 9 TasI,Tsp509I,Sse9I TspRI 3 TscAI XhoII 1 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AccI AcyI AflII AflIII AgeI AlfI AloI ApaI ApaLI AscI AvaI AvaII AvrII BalI BamHI BarI BbvI BciVI BclI BdaI BetI* BglI BmeT110I BmtI BplI BsaBI BsaXI BsePI BseRI BseSI BseYI BsgI BsiI* BslFI BsmFI BsmI Bsp120I Bsp1407I BspLU11I* BspMI BspMII* BspOI BssNAI Bst1107I BstAPI BstEII BstZ17I BtgZI BtrI CauII* Cfr10I Cfr9I CfrI CspCI DinI DraII DraIII Eam1105I Ecl136II Eco31I EcoICRI EcoNI EcoRI EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FauI FnuDII* FseI FspAI GsaI HgaI HgiAI* HgiJII* HindII HpaI HpaII Hpy99I KasI Ksp632I* MauBI MluI Mph1103I MroNI MstI* NaeI NarI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* OliI PacI PasI PmaCI PmeI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SduI SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI TseI Tsp45I TspGWI TspMI TstI Tth111I VspI XbaI XcmI XhoI XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769