Restriction Map of SWI5/YDR146C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

SWI5/YDR146C on chromosome IV from coordinates 750742 to 748613.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.30777

EMBOSS_001 TatI |Csp6I CviJI ||RsaI | ApoI SfaNI |||MnlI | TspEI SetI \ \\\\ \ \ \ ATGGATACATCAAACTCTTGGTTTGATGCCTCAAAAGTACAAAGCCTAAATTTTGACCTA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTATGTAGTTTGAGAACCAAACTACGGAGTTTTCATGTTTCGGATTTAAAACTGGAT / /// / / / SfaNI ||| CviJI | SetI ||TatI TspEI |Csp6I ApoI MnlI RsaI M D T S N S W F D A S K V Q S L N F D L W I H Q T L G L M P Q K Y K A * I L T Y G Y I K L L V * C L K S T K P K F * P T ----:----|----:----|----:----|----:----|----:----|----:----| X S V D F E Q N S A E F T C L R F K S R X P Y M L S K T Q H R L L V F G L N Q G H I C * V R P K I G * F Y L A * I K V * MaeIII Tsp45I | BtsI Hin4II* MnlI | TspRI | CviRI* | MaeI | | TaqI | Hin4II* \ \ \ \ \ \ \ CAAACCAACTCTTATTACTCAAATGCTAGAGGCAGTGACCCTTCGAGTTATGCAATAGAA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTGGTTGAGAATAATGAGTTTACGATCTCCGTCACTGGGAAGCTCAATACGTTATCTT / / / / / / / // MnlI | TspRI | | | | |CviRI* MaeI | | | | Hin4II* | | | Hin4II* | | TaqI | Tsp45I | MaeIII BtsI Q T N S Y Y S N A R G S D P S S Y A I E K P T L I T Q M L E A V T L R V M Q * K N Q L L L L K C * R Q * P F E L C N R R ----:----|----:----|----:----|----:----|----:----|----:----| C V L E * * E F A L P L S G E L * A I S V F W S K N S L H * L C H G K S N H L L L G V R I V * I S S A T V R R T I C Y F MaeI SetI \ \ GGCGAATATAAAACACTAGCAACAGATGATTTAGGCAATATATTGAACCTAAACTATGGT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CCGCTTATATTTTGTGATCGTTGTCTACTAAATCCGTTATATAACTTGGATTTGATACCA / / MaeI SetI G E Y K T L A T D D L G N I L N L N Y G A N I K H * Q Q M I * A I Y * T * T M V R I * N T S N R * F R Q Y I E P K L W * ----:----|----:----|----:----|----:----|----:----|----:----| P S Y L V S A V S S K P L I N F R F * P L R I Y F V L L L H N L C Y I S G L S H A F I F C * C C I I * A I Y Q V * V I T TspDTI | MseI | |TspDTI | || SetI | || | AciI | || | | BseYI | || | | BsiYI* | || | | NspBII* | || | | | GsaI | || | | | AsuI* | || | | | AvaII | || | | | Hin4II* | || | | | |NlaIV | || | | | |BmgT120I | || | | | || Hin4I HphI PsiI | || | | | || Hin4I \ \ \ \\ \ \ \ \\ \ GAAACCAACGAAGTTATAATGAATGAAATAAATGACTTAAACCTTCCGCTGGGACCACTT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTGGTTGCTTCAATATTACTTACTTTATTTACTGAATTTGGAAGGCGACCCTGGTGAA / / / / // / / ////// HphI PsiI | | |SetI | | |||||AvaII | | MseI | | |||||AsuI* | TspDTI | | ||||BmgT120I TspDTI | | |||NlaIV | | ||BseYI | | |Hin4II* | | Hin4I | | Hin4I | NspBII* | AciI | GsaI BsiYI* E T N E V I M N E I N D L N L P L G P L K P T K L * * M K * M T * T F R W D H F N Q R S Y N E * N K * L K P S A G T T F ----:----|----:----|----:----|----:----|----:----|----:----| S V L S T I I F S I F S K F R G S P G S H F W R L * L S H F L H S L G E A P V V F G V F N Y H I F Y I V * V K R Q S W K TspDTI | SetI Hpy188I | | Hin4I Hpy188I | BslFI | | Hin4I | MseI \ \ \ \ \ \ \ TCTGATGAAAAATCTGTCAAGGTTTCTACTTTCTCCGAGTTAATAGGAAATGATTGGCAA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AGACTACTTTTTAGACAGTTCCAAAGATGAAAGAGGCTCAATTATCCTTTACTAACCGTT / / // / / / | BslFI || Hin4I | MseI Hpy188I || Hin4I Hpy188I |SetI TspDTI S D E K S V K V S T F S E L I G N D W Q L M K N L S R F L L S P S * * E M I G K * * K I C Q G F Y F L R V N R K * L A K ----:----|----:----|----:----|----:----|----:----|----:----| E S S F D T L T E V K E S N I P F S Q C K Q H F I Q * P K * K R R T L L F H N A R I F F R D L N R S E G L * Y S I I P L DdeI | TspDTI | | TspEI | | | Hpy178III* | | | | MlyI CviRI* | | | | PleI | MaeI | | | | | MaeIII | | AluI | | | | | Tsp45I | | CviJI | | | | | | HinfI | | | SetI \ \ \ \ \ \ \ \ \ \ \ AGTATGAACTTTGACTTAGAAAATAATTCAAGAGAAGTGACTCTAAATGCAACTAGCTTG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TCATACTTGAAACTGAATCTTTTATTAAGTTCTCTTCACTGAGATTTACGTTGATCGAAC // / / // // / /// |DdeI | | |PleI |HinfI | ||CviJI TspDTI | | MlyI Tsp45I | ||AluI | | MaeIII | |MaeI | Hpy178III* | SetI TspEI CviRI* S M N F D L E N N S R E V T L N A T S L V * T L T * K I I Q E K * L * M Q L A C Y E L * L R K * F K R S D S K C N * L V ----:----|----:----|----:----|----:----|----:----|----:----| L I F K S K S F L E L S T V R F A V L K F Y S S Q S L F Y N L L L S E L H L * S T H V K V * F I I * S F H S * I C S A Q MseI | TspDTI | | Hpy178III* | | | Hin4I | | | Hin4I | | | |Tsp4CI* Hin4I | | | || TspRI Tsp4CI* Hin4I \ \ \ \\ \ \ \ TTGAATGAAAATAGATTAAATCAAGACAGTGGTATGACTGTTTATCAAAAAACAATGAGT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTACTTTTATCTAATTTAGTTCTGTCACCATACTGACAAATAGTTTTTTGTTACTCA / / / / / / | | | Tsp4CI* Tsp4CI* Hin4I | | Hpy178III* Hin4I | | TspRI | Hin4I | Hin4I TspDTI MseI L N E N R L N Q D S G M T V Y Q K T M S * M K I D * I K T V V * L F I K K Q * V E * K * I K S R Q W Y D C L S K N N E * ----:----|----:----|----:----|----:----|----:----|----:----| N F S F L N F * S L P I V T * * F V I L T S H F Y I L D L C H Y S Q K D F F L S Q I F I S * I L V T T H S N I L F C H T FatI NcoI StyI SecI* DsaI* SalI TspDTI |TaqI |CviAII |AccI || MboII |EciI || NlaIII ||HindII CviJI || |AciI TspEI ||Hpy166II \ \\ \\ \ \\\ GATAAGCCCCACGATGAAAAGAAGATTTCCATGGCGGATAATTTATTGTCGACTATAAAC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CTATTCGGGGTGCTACTTTTCTTCTAAAGGTACCGCCTATTAAATAACAGCTGATATTTG / / / // / / / /// CviJI | | || AciI | | ||SalI | | |DsaI* | | |AccI | | |SecI* | | |TaqI | | |StyI | | Hpy166II | | |NcoI | | HindII | | |FatI | EciI | | CviAII TspEI | | MboII | NlaIII TspDTI D K P H D E K K I S M A D N L L S T I N I S P T M K R R F P W R I I Y C R L * T * A P R * K E D F H G G * F I V D Y K Q ----:----|----:----|----:----|----:----|----:----|----:----| S L G W S S F F I E M A S L K N D V I F H Y A G R H F S S K W P P Y N I T S * L I L G V I F L L N G H R I I * Q R S Y V SecI* |AvaI ||SetI ||BmeT110I ||| TspEI TspEI ||| | MnlI | MseI CviJI ||| | | MaeIII | VspI | TaqI ||| | | Tsp4CI* \ \ \ \ \\\ \ \ \ AAAAGTGAAATTAATAAAGGCTTCGATAGAAACCTCGGGGAATTACTGTTACAGCAACAA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTCACTTTAATTATTTCCGAAGCTATCTTTGGAGCCCCTTAATGACAATGTCGTTGTT // / / / // / / / / |VspI | TaqI SetI || | | | MaeIII |MseI CviJI || | | Tsp4CI* TspEI || | TspEI || MnlI |AvaI BmeT110I SecI* K S E I N K G F D R N L G E L L L Q Q Q K V K L I K A S I E T S G N Y C Y S N N K * N * * R L R * K P R G I T V T A T T ----:----|----:----|----:----|----:----|----:----|----:----| L L S I L L P K S L F R P S N S N C C C C F H F * Y L S R Y F G R P I V T V A V F T F N I F A E I S V E P F * Q * L L L Hin6I |GlaI ||HhaI ||FnuDII* ||| Cac8I MnlI ||| | MfeI SduI ||| | TspEI HgiAI* CviJI \\\ \ \ \ \ CAAGAGTTGCGCGAGCAATTGAGAGCACAACAAGAGGCTAATAAGAAGTTAGAGTTAGAA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCTCAACGCGCTCGTTAACTCTCGTGTTGTTCTCCGATTATTCTTCAATCTCAATCTT /// / / / / / ||| Cac8I | | MnlI CviJI ||FnuDII* | HgiAI* ||Hin6I | SduI |GlaI TspEI HhaI MfeI Q E L R E Q L R A Q Q E A N K K L E L E K S C A S N * E H N K R L I R S * S * N R V A R A I E S T T R G * * E V R V R T ----:----|----:----|----:----|----:----|----:----|----:----| C S N R S C N L A C C S A L L F N S N S V L T A R A I S L V V L P * Y S T L T L L L Q A L L Q S C L L L S I L L * L * F Hpy188I CviJI | AsuI* | DdeI | AvaII SfeI* | |SetI BccI | |BmgT120I \ \ \\ \ \ \\ CTCAAACAAACACAATACAAGCAACAACAACTACAGGCTACCTTAGAGAACTCTGATGGT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| GAGTTTGTTTGTGTTATGTTCGTTGTTGTTGATGTCCGATGGAATCTCTTGAGACTACCA / / / / / / / | | SetI DdeI | | BmgT120I | CviJI | Hpy188I SfeI* BccI L K Q T Q Y K Q Q Q L Q A T L E N S D G S N K H N T S N N N Y R L P * R T L M V Q T N T I Q A T T T T G Y L R E L * W S ----:----|----:----|----:----|----:----|----:----|----:----| S L C V C Y L C C C S C A V K S F E S P V * V F V I C A V V V V P * R L S S Q H E F L C L V L L L L * L S G * L V R I T Eco57I Eco57MI | MboI | BglII AccI | XhoII |BseGI Hpy166II | | DpnI Hpy188I |BssNAI | Tsp4CI* | | |BstKTI MboII | MnlI |Hpy166II \ \ \ \ \\ \ \ \ \\ CCACAGTTTTTATCTCCCAAAAGGAAGATCTCTCCTGCTTCAGAAAATGTGGAGGATGTA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GGTGTCAAAAATAGAGGGTTTTCCTTCTAGAGAGGACGAAGTCTTTTACACCTCCTACAT / / / // / / / / / / | Tsp4CI* | || | MboII | MnlI | Hpy166II Hpy166II | || XhoII Hpy188I | BssNAI AvaII | || BglII BseGI AsuI* | || MboI | |DpnI | BstKTI Eco57MI Eco57I P Q F L S P K R K I S P A S E N V E D V H S F Y L P K G R S L L L Q K M W R M Y T V F I S Q K E D L S C F R K C G G C I ----:----|----:----|----:----|----:----|----:----|----:----| G C N K D G L L F I E G A E S F T S S T D V T K I E W F S S R E Q K L F H P P H W L K * R G F P L D R R S * F I H L I Y HphI Hpy166II | MaeIII | Tsp45I FokI | BstEII |HphI | |BsrI || CviJI | |TspRI \\ \ \ \\ TACGCAAATAGCCTTTCACCAATGATTTCCCCACCAATGTCTAATACTTCGTTCACTGGG 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| ATGCGTTTATCGGAAAGTGGTTACTAAAGGGGTGGTTACAGATTATGAAGCAAGTGACCC / / / /// / AccI | CviJI ||| BsrI | FokI ||Hpy166II HphI |HphI TspRI Y A N S L S P M I S P P M S N T S F T G T Q I A F H Q * F P H Q C L I L R S L G R K * P F T N D F P T N V * Y F V H W V ----:----|----:----|----:----|----:----|----:----|----:----| Y A F L R E G I I E G G I D L V E N V P I R L Y G K V L S K G V L T * Y K T * Q V C I A K * W H N G W W H R I S R E S P TatI SfeI* BfiI |Csp6I Cac8I |SetI ||RsaI | CviRI* Csp6I || MaeI Hin4II* ||ScaI | | PstI MaeI |RsaI \\ \ \ \\\ \ \ \ \ \\ TCACCTTCTAGGAGAAACAATAGACAAAAGTACTGCCTGCAGAGAAAAAACTCTAGTGGT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| AGTGGAAGATCCTCTTTGTTATCTGTTTTCATGACGGACGTCTCTTTTTTGAGATCACCA / / / / /// / / / / / / | | | Hin4II* ||| | | SfeI* | | RsaI | | MaeI ||| | CviRI* | TstI | BstEII ||| Cac8I MaeI | Tsp45I ||| PstI | MaeIII ||TatI | BfiI |Csp6I SetI ScaI RsaI S P S R R N N R Q K Y C L Q R K N S S G H L L G E T I D K S T A C R E K T L V V T F * E K Q * T K V L P A E K K L * W Y ----:----|----:----|----:----|----:----|----:----|----:----| D G E L L F L L C F Y Q R C L F F E L P T V K * S F C Y V F T S G A S F F S * H * R R P S V I S L L V A Q L S F V R T T PfoI BssKI TstI EcoRII SfeI* | ScrFI |Tsp4CI* | BseBI || AsuI* | | TspEI SetI || AvaII | | | Hin4II* |MlyI HinfI || |BmgT120I | | | | TstI |PleI | HphI \\ \\ \ \ \ \ \ \\ \ \ ACTGTAGGACCACTATGTTTCCAGGAATTGAACGAAGGTTTCAATGACTCCCTCATTTCA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TGACATCCTGGTGATACAAAGGTCCTTAACTTGCTTCCAAAGTTACTGAGGGAGTAAAGT // / // / / / / / // / / || | |AvaII | | | TspEI SetI |PleI HinfI MnlI || | |AsuI* | | | TstI MlyI HphI || | BmgT120I | | Hin4II* || SfeI* | EcoRII |Tsp4CI* | BssKI Csp6I | PfoI BseBI ScrFI T V G P L C F Q E L N E G F N D S L I S L * D H Y V S R N * T K V S M T P S F H C R T T M F P G I E R R F Q * L P H F T ----:----|----:----|----:----|----:----|----:----|----:----| V T P G S H K W S N F S P K L S E R M E Y Q L V V I N G P I S R L N * H S G * K S Y S W * T E L F Q V F T E I V G E N * TspDTI | MnlI | | BspCNI TaqI | | |BseMII ApoI | TfiI DdeI | | ||ApoI MnlI TspEI | HinfI |SetI | | ||TspEI \ \ \ \ \\ \ \ \\\ CCAAAGAAAATTCGCTCGAATCCAAATGAAAACCTCAGTTCAAAAACCAAATTTATTACG 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTTCTTTTAAGCGAGCTTAGGTTTACTTTTGGAGTCAAGTTTTTGGTTTAAATAATGC / / / / / / / // / TspEI | HinfI SetI | | | |BseMII TspEI ApoI | TfiI | | | BspCNI ApoI TaqI | | MnlI | TspDTI DdeI P K K I R S N P N E N L S S K T K F I T Q R K F A R I Q M K T S V Q K P N L L R K E N S L E S K * K P Q F K N Q I Y Y A ----:----|----:----|----:----|----:----|----:----|----:----| G F F I R E F G F S F R L E F V L N I V V L S F E S S D L H F G * N L F W I * * W L F N A R I W I F V E T * F G F K N R AluI CviJI | SetI | |MaeII | || SetI PsrI | || TaiI | Hin4II* | || | PsrI \ \ \ \\ \ \ CCCTTCACTCCAAAGAGTAGAGTTAGTTCAGCTACGTCCAACTCTGCTAACATTACCCCT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| GGGAAGTGAGGTTTCTCATCTCAATCAAGTCGATGCAGGTTGAGACGATTGTAATGGGGA / / / / / / / PsrI Hin4II* | | | MaeII MmeI | | | PsrI | | TaiI | | SetI | CviJI | AluI SetI P F T P K S R V S S A T S N S A N I T P P S L Q R V E L V Q L R P T L L T L P L L H S K E * S * F S Y V Q L C * H Y P * ----:----|----:----|----:----|----:----|----:----|----:----| G K V G F L L T L E A V D L E A L M V G A R * E L S Y L * N L * T W S Q * C * G G E S W L T S N T * S R G V R S V N G R MboI MmeI | DpnI | SmlI Hpy178III* | |BstKTI | AflII | MseI | ||Hpy178III* | |MseI SetI | VspI | ||| MboII SspI Hpy188I \ \\ \ \ \ \ \\\ \ \ \ AATAACTTAAGGTTAGATTTCAAGATTAATGTTGAAGATCAGGAAAGCGAATATTCAGAG 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTGAATTCCAATCTAAAGTTCTAATTACAACTTCTAGTCCTTTCGCTTATAAGTCTC // / / // / / / / / |AflII | VspI || | | MboII | Hpy188I |SmlI | MseI || | | SspI MseI Hpy178III* || | Hpy178III* SetI || MboI |DpnI BstKTI N N L R L D F K I N V E D Q E S E Y S E I T * G * I S R L M L K I R K A N I Q R * L K V R F Q D * C * R S G K R I F R E ----:----|----:----|----:----|----:----|----:----|----:----| L L K L N S K L I L T S S * S L S Y E S * Y S L T L N * S * H Q L D P F R I N L I V * P * I E L N I N F I L F A F I * L BssKI SetI SexAI | AsuI* EcoRII | |BmgT120I | ScrFI | ||BssKI | BseBI | ||CviJI | | AsuI* | ||EcoRII | | AvaII | ||HaeIII | | DraII | |||SecI* | | PpuMI | ||||ScrFI | | |BmgT120I | ||||BseBI | | ||SetI Hin4II* \ \\\\\ \ \ \\\ \ AAACCTTTGGGCCTGGGTATTGAACTTCTTGGAAAACCAGGTCCTTCTCCTACAAAATCA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGGAAACCCGGACCCATAACTTGAAGAACCTTTTGGTCCAGGAAGAGGATGTTTTAGT / // / / // /// / / SetI || | EcoRII || ||PpuMI | TspRI || | BssKI || ||DraII Hin4II* || | SecI* || ||AvaII || BseBI || ||AsuI* || ScrFI || |BmgT120I |AsuI* || EcoRII BmgT120I || SexAI HaeIII || BssKI CviJI |BseBI |ScrFI SetI K P L G L G I E L L G K P G P S P T K S N L W A W V L N F L E N Q V L L L Q N Q T F G P G Y * T S W K T R S F S Y K I S ----:----|----:----|----:----|----:----|----:----|----:----| F G K P R P I S S R P F G P G E G V F D S V K P G P Y Q V E Q F V L D K E * L I F R Q A Q T N F K K S F W T R R R C F * TspEI | BssKI | EcoRII TspRI | |SecI* | MseI | ||ScrFI | |AhaIII* | ||BseBI \ \\ \ \\\ GTGTCTTTAAAGAGTGCTTCTGTGGATATTATGCCTACAATTCCTGGGTCTGTAAATAAT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CACAGAAATTTCTCACGAAGACACCTATAATACGGATGTTAAGGACCCAGACATTTATTA // / / / |MseI | | EcoRII AhaIII* | | BssKI | | SecI* | BseBI | ScrFI TspEI V S L K S A S V D I M P T I P G S V N N C L * R V L L W I L C L Q F L G L * I I V F K E C F C G Y Y A Y N S W V C K * Y ----:----|----:----|----:----|----:----|----:----|----:----| T D K F L A E T S I I G V I G P D T F L L T K L S H K Q P Y * A * L E Q T Q L Y H R * L T S R H I N H R C N R P R Y I I FalI FalI | BccI MnlI | | GsuI BciVI |FalI | | Eco57MI | BsrI |FalI MnlI \ \ \ \ \ \\ \ ACTCCATCAGTCAATAAAGTATCCCTTTCCTCCAGTTATATAGACCAATATACACCAAGA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TGAGGTAGTCAGTTATTTCATAGGGAAAGGAGGTCAATATATCTGGTTATATGTGGTTCT / / // / / / / FalI Eco57MI |BsrI | MnlI MnlI SetI FalI BccI BciVI FalI GsuI FalI T P S V N K V S L S S S Y I D Q Y T P R L H Q S I K Y P F P P V I * T N I H Q E S I S Q * S I P F L Q L Y R P I Y T K R ----:----|----:----|----:----|----:----|----:----|----:----| V G D T L L T D R E E L * I S W Y V G L Y E M L * Y L I G K R W N Y L G I Y V L S W * D I F Y G K G G T I Y V L I C W S TspRI Hin4I | CviRI* Hin4I AluI | | BbvI | TseI CviJI | | BsmI | |BisI SetI MaeIII | SetI | | EcoT22I | ||BlsI \ \ \ \ \ \ \ \ \\\ GGTAAGCAGTTACACTTTAGCTCTATCAGTGAGAATGCATTGGGTATCAATGCTGCGACA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CCATTCGTCAATGTGAAATCGAGATAGTCACTCTTACGTAACCCATAGTTACGACGCTGT / / / / / / / /// | | | TspRI | | Hin4I ||TseI | | CviJI | | Hin4I |BisI | | AluI | | BbvI BlsI | SetI | CviRI* MaeIII | BsmI EcoT22I G K Q L H F S S I S E N A L G I N A A T V S S Y T L A L S V R M H W V S M L R H * A V T L * L Y Q * E C I G Y Q C C D T ----:----|----:----|----:----|----:----|----:----|----:----| P L C N C K L E I L S F A N P I L A A V L Y A T V S * S * * H S H M P Y * H Q S T L L * V K A R D T L I C Q T D I S R C CviJI CviJI Hin4I |AciI Hin4I |BisI |MwoI Hin4II* ||BlsI ||Cac8I | Hpy178III* |||TauI ||| Cac8I | | NmeAIII \\\\ \\\ \ \ \ \ CCACATCTAAAGCCGCCGAGCCAGCAAGCACGACATCGGGAAGGCGTTTTCAATGATTTA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| GGTGTAGATTTCGGCGGCTCGGTCGTTCGTGCTGTAGCCCTTCCGCAAAAGTTACTAAAT //// / / / / / / |||| | | | Cac8I | Hpy178III* |||| | | Cac8I | NmeAIII |||| | CviJI Hin4II* |||| MwoI |||Hin4I |||Hin4I |||AciI ||BisI |BlsI CviJI TauI P H L K P P S Q Q A R H R E G V F N D L H I * S R R A S K H D I G K A F S M I * T S K A A E P A S T T S G R R F Q * F R ----:----|----:----|----:----|----:----|----:----|----:----| G C R F G G L W C A R C R S P T K L S K V V D L A A S G A L V V D P L R K * H N W M * L R R A L L C S M P F A N E I I * TatI |Csp6I ||RsaI Hin4II* MnlI TspDTI CviJI \\\ \ \ \ \ GACCCTAATGTACTTACGAAAAATACAGACAATGAAGGAGATGATAATGAGGAAAATGAG 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| CTGGGATTACATGAATGCTTTTTATGTCTGTTACTTCCTCTACTATTACTCCTTTTACTC /// / / / / ||TatI Hin4II* | TspDTI CviJI |Csp6I MnlI RsaI D P N V L T K N T D N E G D D N E E N E T L M Y L R K I Q T M K E M I M R K M S P * C T Y E K Y R Q * R R * * * G K * A ----:----|----:----|----:----|----:----|----:----|----:----| S G L T S V F F V S L S P S S L S S F S L G * H V * S F Y L C H L L H Y H P F H V R I Y K R F I C V I F S I I I L F I L Hin4II* | SmlI | AflII | |MseI | || MaeIII | || Tsp45I Hin4II* BsaXI Hpy188I | || |BsaXI | Csp6I \ \ \ \\ \\ \ \ CCTGAAAGTAGATTTGTTATTTCCGAAACGCCTTCTCCCGTTCTTAAGTCACAAAGTAAG 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| GGACTTTCATCTAAACAATAAAGGCTTTGCGGAAGAGGGCAAGAATTCAGTGTTTCATTC / / / /// / / BsaXI Hpy188I | ||| | Hin4II* | ||| Tsp45I | ||| MaeIII | ||AflII | ||SmlI | |MseI | BsaXI Hin4II* P E S R F V I S E T P S P V L K S Q S K L K V D L L F P K R L L P F L S H K V S * K * I C Y F R N A F S R S * V T K * V ----:----|----:----|----:----|----:----|----:----|----:----| G S L L N T I E S V G E G T R L D C L L A Q F Y I Q * K R F A K E R E * T V F Y R F T S K N N G F R R R G N K L * L T L RsaI | BseRI | | MboI | | BglII | | XhoII | | | DpnI | | | |BstKTI | | | || TspEI | | | || |MboII | | | || || BsiYI* TstI | | | || || | MnlI MseI | BslFI \ \ \ \\ \\ \ \ \ \ \ TACGAAGGAAGATCTCCTCAATTCGGCACACACATTAAGGAAATCAACACATATACCACA 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| ATGCTTCCTTCTAGAGGAGTTAAGCCGTGTGTGTAATTCCTTTAGTTGTGTATATGGTGT /// // / / / / / / / ||BseRI || | | | MnlI MseI TstI BslFI |Csp6I || | | TspEI RsaI || | BsiYI* || | MboII || XhoII || BglII || MboI |DpnI BstKTI Y E G R S P Q F G T H I K E I N T Y T T T K E D L L N S A H T L R K S T H I P Q R R K I S S I R H T H * G N Q H I Y H K ----:----|----:----|----:----|----:----|----:----|----:----| Y S P L D G * N P V C M L S I L V Y V V T R L F I E E I R C V C * P F * C M Y W V F S S R R L E A C V N L F D V C I G C BtsI |Hin4I MnlI || MnlI TaqI | TstI || | TspRI SetI ClaI Hin4II* \ \ \\ \ \ \ \ \ AATAGTCCCTCAAAAATCACAAGAAAACTCACAACACTGCCCAGAGGTTCAATCGATAAA 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TTATCAGGGAGTTTTTAGTGTTCTTTTGAGTGTTGTGACGGGTCTCCAAGTTAGCTATTT / / / / / / / / | MnlI | | MnlI SetI | Hin4II* TstI | TspRI ClaI | BtsI TaqI Hin4I N S P S K I T R K L T T L P R G S I D K I V P Q K S Q E N S Q H C P E V Q S I N * S L K N H K K T H N T A Q R F N R * I ----:----|----:----|----:----|----:----|----:----|----:----| F L G E F I V L F S V V S G L P E I S L L Y D R L F * L F V * L V A W L N L R Y I T G * F D C S F E C C Q G S T * D I F PfoI BssKI EcoRII | ScrFI | BseBI | | TatI | | Bsp1407I | | |Csp6I | | ||RsaI Hin4I MslI | | |||BseGI FokI \ \ \ \ \\\\ \ TATGTGAAGGAAATGCCTGATAAAACATTTGAATGTTTATTTCCTGGATGTACAAAAACA 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| ATACACTTCCTTTACGGACTATTTTGTAAACTTACAAATAAAGGACCTACATGTTTTTGT / / / / //// Hin4I MslI | | |||Bsp1407I | | |||TatI | | ||Csp6I | | |RsaI | | BseGI | EcoRII | BssKI | PfoI BseBI ScrFI Y V K E M P D K T F E C L F P G C T K T M * R K C L I K H L N V Y F L D V Q K H C E G N A * * N I * M F I S W M Y K N I ----:----|----:----|----:----|----:----|----:----|----:----| Y T F S I G S L V N S H K N G P H V F V I H S P F A Q Y F M Q I N I E Q I Y L F I H L F H R I F C K F T * K R S T C F C MboI MboI | DpnI BglII | |BstKTI XhoII | ||CfrI Hin4II* Hpy188I | ||| CviJI |Hpy178III* | DpnI | ||| HaeIII || SetI | |BstKTI | ||| | MboII \\ \ \ \\ \ \\\ \ \ TTCAAGAGAAGGTATAACATCAGATCTCATATTCAAACACATTTGGAAGATCGGCCATAT 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTTCTCTTCCATATTGTAGTCTAGAGTATAAGTTTGTGTAAACCTTCTAGCCGGTATA / / / / / // / // / / // / | | | SetI | || XhoII || | | || HphI | | Hpy178III* | || BglII || | | |MboII | FokI | || MboI || | | CfrI Hin4II* | |DpnI || | HaeIII | BstKTI || | CviJI Hpy188I || MboI |DpnI BstKTI F K R R Y N I R S H I Q T H L E D R P Y S R E G I T S D L I F K H I W K I G H I Q E K V * H Q I S Y S N T F G R S A I F ----:----|----:----|----:----|----:----|----:----|----:----| N L L L Y L M L D * I * V C K S S R G Y M * S F T Y C * I E Y E F V N P L D A M E L S P I V D S R M N L C M Q F I P W I MboI BclI | DpnI | |BstKTI | || BssKI FatI | || SecI* BspHI | || EcoRII |CviAII | || | ScrFI Csp6I |Hpy178III* HphI | || | BseBI BseGI FokI |RsaI || NlaIII \ \ \\ \ \ \ \ \\ \\ \ TCCTGTGATCACCCTGGATGTGATAAGGCATTTGTACGAAATCATGACTTGATAAGACAC 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| AGGACACTAGTGGGACCTACACTATTCCGTAAACATGCTTTAGTACTGAACTATTCTGTG // / /// / / // / // || BclI ||| BseGI | |Csp6I | |BspHI || MboI ||EcoRII | RsaI | |FatI |DpnI ||BssKI FokI | Hpy178III* BstKTI |SecI* | CviAII BseBI NlaIII ScrFI S C D H P G C D K A F V R N H D L I R H P V I T L D V I R H L Y E I M T * * D T L * S P W M * * G I C T K S * L D K T Q ----:----|----:----|----:----|----:----|----:----|----:----| E Q S * G P H S L A N T R F * S K I L C N R H D G Q I H Y P M Q V F D H S S L V G T I V R S T I L C K Y S I M V Q Y S V FatI CviRI* |CviAII ||EcoT22I BslFI ||| NspI ApoI |BsiYI* ||| NlaIII TspEI \\ \\\ \ \ AAAAAATCGCACCAAGAAAAGGCGTATGCATGTCCCTGTGGTAAGAAATTCAATAGAGAA 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTTAGCGTGGTTCTTTTCCGCATACGTACAGGGACACCATTCTTTAAGTTATCTCTT / / / / // / | | | | |FatI TspEI | | | | CviAII ApoI | | | CviRI* | | | NlaIII | | | NspI | | EcoT22I | BslFI BsiYI* K K S H Q E K A Y A C P C G K K F N R E K N R T K K R R M H V P V V R N S I E K K I A P R K G V C M S L W * E I Q * R R ----:----|----:----|----:----|----:----|----:----|----:----| L F D C W S F A Y A H G Q P L F N L L S C F I A G L F P T H M D R H Y S I * Y L F F R V L F L R I C T G T T L F E I S F BbvII* | HgaI | MboII | | ApaLI TseI | | | CviRI* CviRI* | | | Hpy166II |BisI | | | | SduI ||BlsI | | | | BseSI |||AciI | | | | HgiAI* |||NspBII* BbvI MaeII \ \ \ \ \ \\\\ \ \ GACGCTTTGGTTGTGCACAGAAGTAGAATGATTTGCAGCGGTGGTAAAAAGTATGAAAAC 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCGAAACCAACACGTGTCTTCATCTTACTAAACGTCGCCACCATTTTTCATACTTTTG / / / / //// / / / | | | ApaLI |||| AciI BbvI TaiI | | Hpy166II |||NspBII* SetI | | CviRI* |||TseI | | HgaI ||BisI | HgiAI* |BlsI | BseSI CviRI* | SduI BbvII* MboII D A L V V H R S R M I C S G G K K Y E N T L W L C T E V E * F A A V V K S M K T R F G C A Q K * N D L Q R W * K V * K R ----:----|----:----|----:----|----:----|----:----|----:----| S A K T T C L L L I I Q L P P L F Y S F L R K P Q A C F Y F S K C R H Y F T H F V S Q N H V S T S H N A A T T F L I F V SetI TaiI SetI | TspEI | BsmAI BbvII* | | MseI | Eco31I |BccI | | TspDTI | | MnlI || MboII \ \ \ \ \ \ \\ \ GTGGTAATTAAAAGGTCTCCAAGAAAAAGAGGAAGACCAAGAAAAGATGGAACTTCAAGT 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| CACCATTAATTTTCCAGAGGTTCTTTTTCTCCTTCTGGTTCTTTTCTACCTTGAAGTTCA / / // / / / / / | | || SetI | Eco31I | BbvII* | | |MseI | BsmAI | MboII | | TspEI MnlI BccI | TspDTI MaeII V V I K R S P R K R G R P R K D G T S S W * L K G L Q E K E E D Q E K M E L Q V G N * K V S K K K R K T K K R W N F K C ----:----|----:----|----:----|----:----|----:----|----:----| T T I L L D G L F L P L G L F S P V E L R P L * F T E L F F L F V L F L H F K L H Y N F P R W S F S S S W S F I S S * T MboI | DpnI SspI | |BstKTI MaeI | MseI | || BinI* Tsp4CI* \ \ \ \ \\ \ \ GTTTCTAGTAGTCCAATCAAAGAAAATATTAACAAGGATCATAATGGACAGTTGATGTTC 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| CAAAGATCATCAGGTTAGTTTCTTTTATAATTGTTCCTAGTATTACCTGTCAACTACAAG / / / // / / / MaeI | MseI || MboI | Tsp4CI* SspI |DpnI BinI* BstKTI V S S S P I K E N I N K D H N G Q L M F F L V V Q S K K I L T R I I M D S * C S F * * S N Q R K Y * Q G S * W T V D V Q ----:----|----:----|----:----|----:----|----:----|----:----| T E L L G I L S F I L L S * L P C N I N H K * Y D L * L F Y * C P D Y H V T S T N R T T W D F F I N V L I M I S L Q H E HindIII | AluI | CviJI | | SetI | | | MboI | | | | DpnI | | | | |BstKTI | | | | || Ksp632I* BspCNI | | | | || |DdeI |BseMII | | | | || || MboII ||BccI | | | | || || Hpy188I |||MboII \ \ \ \ \\ \\ \ \\\\ AAGCTTGAAGATCAACTCAGAAGAGAGCGTAGTTATGATGGGAATGGAACGGGGATTATG 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| TTCGAACTTCTAGTTGAGTCTTCTCTCGCATCAATACTACCCTTACCTTGCCCCTAATAC / / / // / // // // | | | || MboI |DdeI || |BccI | | | |DpnI Ksp632I* || MboII | | | BstKTI Hpy188I |BseMII | | HindIII MboII BspCNI | CviJI | AluI SetI K L E D Q L R R E R S Y D G N G T G I M S L K I N S E E S V V M M G M E R G L W A * R S T Q K R A * L * W E W N G D Y G ----:----|----:----|----:----|----:----|----:----|----:----| L S S S * S L L S R L * S P F P V P I I * A Q L D V * F L A Y N H H S H F P S * L K F I L E S S L T T I I P I S R P N H TspDTI | SetI \ \ GTTTCGCCAATGAAAACTAATCAAAGGTAA 2110 2120 2130 ----:----|----:----|----:----| CAAAGCGGTTACTTTTGATTAGTTTCCATT // |SetI TspDTI V S P M K T N Q R * F R Q * K L I K G X F A N E N * S K V X ----:----|----:----|----:----| T E G I F V L * L Y P K A L S F * D F T N R W H F S I L P L # Enzymes that cut Frequency Isoschizomers AccI 2 FblI,XmiI AciI 4 BspACI,SsiI AflII 2 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AhaIII* 1 DraI AluI 4 AluBI ApaLI 1 Alw44I,VneI ApoI 4 AcsI,XapI AsuI* 5 Cfr13I,PspPI,Sau96I,AspS9I AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 4 Bme18I,Eco47I,SinI,VpaK11BI BbvI 2 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 4 BciVI 1 BfuI BclI 1 FbaI,Ksp22I BfiI 1 BmrI,BmuI BglII 3 BinI* 1 AlwI,BspPI,AclWI BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BmeT110I 1 BmgT120I 5 BsaXI 1 BseBI 6 Bst2UI,BstNI,BstOI,MvaI BseGI 3 BstF5I,BtsCI BseMII 2 BseRI 1 BseSI 1 BaeGI,BstSLI BseYI 1 BsiYI* 3 Bsc4I,BseLI,BslI,AfiI BslFI 3 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI Bsp1407I 1 BsrGI,BstAUI BspCNI 2 BspHI 1 CciI,PagI,RcaI BsrI 2 BseNI,Bse1I,BsrSI BssKI 6 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 8 BtsI 2 Cac8I 4 BstC8I CfrI 1 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 7 CviQI,RsaNI CviAII 3 CviJI 15 CviKI-1 CviRI* 7 HpyCH4V DdeI 4 BstDEI,HpyF3I DpnI 8 MalI DraII 1 EcoO109I DsaI* 1 BtgI,BstDSI EciI 1 Eco31I 1 Bso31I,BspTNI,BsaI Eco57I 1 AcuI Eco57MI 2 EcoRII 6 AjnI,Psp6I,PspGI EcoT22I 2 Mph1103I,NsiI,Zsp2I FalI 2 FatI 3 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 3 GlaI 1 GsaI 1 GsuI 1 BpmI HaeIII 2 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiAI* 2 Bbv12I,BsiHKAI,Alw21I HhaI 1 BstHHI,CfoI,AspLEI Hin4I 7 Hin4II* 13 HpyAV Hin6I 1 HinP1I,HspAI HindII 1 HincII HindIII 1 HinfI 3 HphI 5 AsuHPI Hpy166II 5 Hpy8I Hpy178III* 7 Hpy188III Hpy188I 8 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 6 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 6 MboI 8 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 9 MfeI 1 MunI MlyI 2 SchI MmeI 1 MnlI 14 MseI 11 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 1 HpyF10VI,BstMWI NcoI 1 Bsp19I NlaIII 3 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I NmeAIII 1 NspBII* 2 MspA1I NspI 1 BstNSI,XceI PfoI 2 PleI 2 PpsI PpuMI 1 Psp5II,PspPPI PsiI 1 AanI PsrI 1 PstI 1 RsaI 7 AfaI SalI 1 ScaI 1 BmcAI,AssI,ZrmI ScrFI 6 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 5 BseDI,BssECI,BsaJI SetI 23 SexAI 1 MabI SfaNI 1 LweI SfeI* 3 BstSFI,SfcI,BfmI SmlI 2 SmoI SspI 2 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 2 TaqI 5 TatI 4 TauI 1 TfiI 1 PfeI TseI 2 ApeKI Tsp45I 4 NmuCI Tsp4CI* 6 HpyCH4III,TaaI,Bst4CI TspDTI 10 TspEI 13 TasI,Tsp509I,Sse9I TspRI 6 TscAI TstI 2 VspI 2 PshBI,AseI XhoII 3 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AcyI AflIII AgeI AjuI AlfI AloI AlwNI ApaI AscI Asp718I AsuII AvrII BaeI BalI BamHI BarI BbvCI Bce83I* BceAI BcgI BdaI BetI* BglI BmtI BplI Bpu10I BsaAI BsaBI BsePI BsgI BsiI* Bsp120I BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BstAPI BstXI BtgZI BtrI CauII* Cfr10I Cfr9I CspCI DinI DraIII DrdI Eam1105I Ecl136II Eco47III EcoICRI EcoNI EcoP15I EcoRI EcoRV EgeI EheI Esp3I EspI* FauI FseI FspAI HaeII HgiCI* HgiJII* HpaI HpaII Hpy99I KasI KpnI MauBI McrI* MluI MroNI MstI* NaeI NarI NdeI NgoMIV NheI NotI NruI OliI PacI PasI PflMI PmaCI PmeI PpiI PshAI PspOMI PspXI PvuI PvuII RsrII SacI SacII SanDI SapI SauI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TaqII TsoI TspGWI TspMI Tth111I XbaI XcmI XhoI XmaCI XmaI XmaIII* XmnI ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769