Restriction Map of GIS1/YDR096W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

GIS1/YDR096W on chromosome IV from coordinates 637139 to 639823.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.29865

MnlI BceAI MseI CviJI BccI | BetI* | CviJI |BsrI |SetI | |HpaII | | BccI \\ \\ \ \\ \ \ \ ATGGAAATCAAGCCAGTTGAGGTTATTGATGGCGTTCCGGTTTTTAAGCCGTCTATGATG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTTTAGTTCGGTCAACTCCAATAACTACCGCAAGGCCAAAAATTCGGCAGATACTAC // / / / // / / / |CviJI | BccI | |BetI* | | BccI BsrI SetI | HpaII | CviJI MnlI BceAI MseI M E I K P V E V I D G V P V F K P S M M W K S S Q L R L L M A F R F L S R L * W G N Q A S * G Y * W R S G F * A V Y D G ----:----|----:----|----:----|----:----|----:----|----:----| X S I L G T S T I S P T G T K L G D I I X P F * A L Q P * Q H R E P K * A T * S H F D L W N L N N I A N R N K L R R H H CviRI* ApoI | ApoI TspEI | TspEI | TspDTI | | TspDTI SspI TspEI | | Hpy188I \ \ \ \ \ \ \ \ GAGTTTGCAAATTTCCAATATTTCATTGATGAAATTACTAAATTCGGAATAGAAAATGGT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CTCAAACGTTTAAAGGTTATAAAGTAACTACTTTAATGATTTAAGCCTTATCTTTTACCA / / / / / / // | | TspEI SspI TspEI | |Hpy188I | | ApoI | TspEI | TspDTI | ApoI CviRI* TspDTI E F A N F Q Y F I D E I T K F G I E N G S L Q I S N I S L M K L L N S E * K M V V C K F P I F H * * N Y * I R N R K W Y ----:----|----:----|----:----|----:----|----:----|----:----| S N A F K W Y K M S S I V L N P I S F P P T Q L N G I N * Q H F * * I R F L F H L K C I E L I E N I F N S F E S Y F I T MnlI AluI CviJI PflMI CviJI | GsuI BsiYI* |Hin4II* | Eco57MI |XcmI ||SetI | | SetI || CviJI ||| HphI | | | AciI \\ \ \\\ \ \ \ \ \ ATTGTCAAAGTCATTCCTCCCAAAGAATGGCTGGAGCTTTTAGAAGGCTCACCTCCTGCG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TAACAGTTTCAGTAAGGAGGGTTTCTTACCGACCTCGAAAATCTTCCGAGTGGAGGACGC / // / / / / / / / | || | | | HphI | Eco57MI AciI | || | | Hin4II* | GsuI | || | | CviJI | SetI | || | | AluI CviJI | || | SetI | || CviJI | |XcmI | MnlI BsiYI* PflMI I V K V I P P K E W L E L L E G S P P A L S K S F L P K N G W S F * K A H L L R C Q S H S S Q R M A G A F R R L T S C G ----:----|----:----|----:----|----:----|----:----|----:----| I T L T M G G L S H S S S K S P E G G A Y Q * L * E E W L I A P A K L L S V E Q N D F D N R G F F P Q L K * F A * R R R MlyI PleI MseI | MaeI TfiI CviJI PflMI MnlI |AhaIII* | | HinfI HinfI |BccI BsiYI* \ \\ \ \ \ \ \\ \ GAAAGTTTAAAGACTATACAACTAGACTCCCCGATTCAACAACAAGCCAAGCGATGGGAC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTCAAATTTCTGATATGTTGATCTGAGGGGCTAAGTTGTTGTTCGGTTCGCTACCCTG / // // / / / / / / MnlI |MseI || | HinfI HinfI | | BsiYI* AhaIII* || MaeI TfiI | | PflMI |PleI | BccI MlyI CviJI E S L K T I Q L D S P I Q Q Q A K R W D K V * R L Y N * T P R F N N K P S D G T K F K D Y T T R L P D S T T S Q A M G Q ----:----|----:----|----:----|----:----|----:----|----:----| S L K F V I C S S E G I * C C A L R H S P F N L S * V V L S G S E V V L W A I P F T * L S Y L * V G R N L L L G L S P V FatI |CviAII || BtgZI || |NlaIII Eam1105I || || BslFI | Csp6I || || | Tsp4CI* Hin4I | |RsaI || || | | TspDTI Hin4I | || TspEI || || | | | TaqI |SfaNI | || | MseI \\ \\ \ \ \ \ \\ \ \\ \ \ AAACATGAAAACGGTGTATTTAGCATCGAAAACGAGTATGACAATAAGTCGTACAATTTA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGTACTTTTGCCACATAAATCGTAGCTTTTGCTCATACTGTTATTCAGCATGTTAAAT / // / / / / / / / / // / / | || | | | TspDTI | TaqI SfaNI | || | MseI | || | | BslFI Hin4I | || Hin4I | || | Tsp4CI* Hin4I | || Hin4I | || BtgZI | || TspEI | |FatI | |Csp6I | CviAII | RsaI NlaIII Eam1105I K H E N G V F S I E N E Y D N K S Y N L N M K T V Y L A S K T S M T I S R T I * T * K R C I * H R K R V * Q * V V Q F N ----:----|----:----|----:----|----:----|----:----|----:----| L C S F P T N L M S F S Y S L L D Y L K C V H F R H I * C R F R T H C Y T T C N F M F V T Y K A D F V L I V I L R V I * CfrI | CviJI | HaeIII | | MboII | | | MlyI | | | PleI | | | | XbaI | | | | |MaeI Hin4I | | | | |Hpy178III* Hin4I | | | | || HinfI | Tsp4CI* | | | | || | Hpy178III* | | TspRI | | | | || | |TaqI SetI MseI \ \ \ \ \ \ \ \\ \ \\ \ \ ACACAGTGGAAGAACTTGGCCGAAAGTCTAGACTCTCGAATAAGTCAAGGTGATTTTAAT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TGTGTCACCTTCTTGAACCGGCTTTCAGATCTGAGAGCTTATTCAGTTCCACTAAAATTA / / /// // // / // / / / | Tsp4CI* ||| || || | |TaqI SetI | HphI TspRI ||| || || | Hpy178III* MseI ||| || || HinfI ||| || |XbaI ||| || Hpy178III* ||| || MaeI ||| |PleI ||| MlyI ||CfrI |MboII HaeIII CviJI T Q W K N L A E S L D S R I S Q G D F N H S G R T W P K V * T L E * V K V I L M T V E E L G R K S R L S N K S R * F * * ----:----|----:----|----:----|----:----|----:----|----:----| V C H F F K A S L R S E R I L * P S K L L V T S S S P R F D L S E F L D L H N * C L P L V Q G F T * V R S Y T L T I K I AciI BisI MseI |BlsI |AhaIII* ||TauI HphI || TspEI ||FnuDII* \ \\ \ \\\ GATAAAACTTTAAAGGAAAATTGCCGCGTAGATAGTCAGCAGGATTGTTATGATTTGGCA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTATTTTGAAATTTCCTTTTAACGGCGCATCTATCAGTCGTCCTAACAATACTAAACCGT // ///// |MseI ||||FnuDII* AhaIII* ||||AciI |||BisI ||BlsI |TauI TspEI D K T L K E N C R V D S Q Q D C Y D L A I K L * R K I A A * I V S R I V M I W H * N F K G K L P R R * S A G L L * F G T ----:----|----:----|----:----|----:----|----:----|----:----| S L V K F S F Q R T S L * C S Q * S K A H Y F K L P F N G R L Y D A P N N H N P I F S * L F I A A Y I T L L I T I I Q C MaeIII Tsp4CI* | EcoP15I BccI | |ApoI | TaqI SetI | |TspEI BtgZI | AsuII | Hin4I \ \\ \ \ \ \ \ CAGTTACAAATTTTAGAAAGTGATTTTTGGAAAACCATCGCTTTTTCGAAACCTTTTTAT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GTCAATGTTTAAAATCTTTCACTAAAAACCTTTTGGTAGCGAAAAAGCTTTGGAAAAATA / / / / / / / / / / | | | TspEI BtgZI | | | Hin4I TspRI | | | ApoI | | SetI | | EcoP15I | AsuII | MaeIII | TaqI Tsp4CI* BccI Q L Q I L E S D F W K T I A F S K P F Y S Y K F * K V I F G K P S L F R N L F M V T N F R K * F L E N H R F F E T F L C ----:----|----:----|----:----|----:----|----:----|----:----| C N C I K S L S K Q F V M A K E F G K * V T V F K L F H N K S F W R K K S V K K L * L N * F T I K P F G D S K R F R K I CviRI* | Hpy166II | | BtsI | | MboII TspEI ApoI | | TspRI |Ksp632I* Hin4I MseI TspEI TspEI \ \ \ \\ \ \ \ \ GCAGTGGACGAAAACTCTTCAATTTTCCCCTATGATTTAACTTTATGGAATTTGAATAAT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CGTCACCTGCTTTTGAGAAGTTAAAAGGGGATACTAAATTGAAATACCTTAAACTTATTA / // // / / | |MboII |Hin4I MseI TspEI | Hpy166II Ksp632I* ApoI | BtsI TspEI CviRI* A V D E N S S I F P Y D L T L W N L N N Q W T K T L Q F S P M I * L Y G I * I I S G R K L F N F P L * F N F M E F E * F ----:----|----:----|----:----|----:----|----:----|----:----| A T S S F E E I K G * S K V K H F K F L H L P R F S K L K G R H N L K I S N S Y C H V F V R * N E G I I * S * P I Q I I Bce83I* | TfiI SmlI MaeIII CviRI* | HinfI | MaeIII Tsp4CI* BsrI | EcoT22I \ \ \ \ \ \ \ \ TTGCCAGATTCTATAAACTCAAGTAACAGACGGTTACTTACTGGTCAGTCTAAATGCATT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| AACGGTCTAAGATATTTGAGTTCATTGTCTGCCAATGAATGACCAGTCAGATTTACGTAA / / / / / / / / / Bce83I* HinfI SmlI | | | BsrI | CviRI* TspEI TfiI | | MaeIII EcoT22I | Tsp4CI* MaeIII L P D S I N S S N R R L L T G Q S K C I C Q I L * T Q V T D G Y L L V S L N A F A R F Y K L K * Q T V T Y W S V * M H F ----:----|----:----|----:----|----:----|----:----|----:----| K G S E I F E L L L R N S V P * D L H M N A L N * L S L Y C V T V * Q D T * I C Q W I R Y V * T V S P * K S T L R F A N FatI NcoI StyI SecI* DsaI* |CviAII AlfI CviRI* SduI || NlaIII AlfI | MslI HgiAI* \\ \ \ \ \ \ TTTCCATGGCATTTGGACGAACAGAATAAATGCTCTATAAACTACTTGCATTTCGGTGCT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| AAAGGTACCGTAAACCTGCTTGTCTTATTTACGAGATATTTGATGAACGTAAAGCCACGA / // / / / / | |DsaI* AlfI | | HgiAI* | |SecI* AlfI | | SduI | |StyI | MslI | |NcoI CviRI* | |FatI | CviAII NlaIII F P W H L D E Q N K C S I N Y L H F G A F H G I W T N R I N A L * T T C I S V L S M A F G R T E * M L Y K L L A F R C S ----:----|----:----|----:----|----:----|----:----|----:----| K G H C K S S C F L H E I F * K C K P A K E M A N P R V S Y I S * L S S A N R H K W P M Q V F L I F A R Y V V Q M E T S PflMI BsiYI* | AlfI Tsp4CI* ApoI | AlfI | AciI TspEI TspEI \ \ \ \ \ \ CCCAAACAATGGTATTCCATACCGTCCGCAAACACAGACCAATTTTTGAAAATTTTATCA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GGGTTTGTTACCATAAGGTATGGCAGGCGTTTGTGTCTGGTTAAAAACTTTTAAAATAGT / / / / / / | AlfI | AciI TspEI TspEI | AlfI Tsp4CI* ApoI BsiYI* PflMI P K Q W Y S I P S A N T D Q F L K I L S P N N G I P Y R P Q T Q T N F * K F Y Q Q T M V F H T V R K H R P I F E N F I K ----:----|----:----|----:----|----:----|----:----|----:----| G L C H Y E M G D A F V S W N K F I K D E W V I T N W V T R L C L G I K S F K I G F L P I G Y R G C V C V L K Q F N * * AluI CviJI NlaIV BccI TspEI | SetI \ \ \ \ \ AAGGAACCATCAAGTAATAAGGAAAATTGTCCAGCTTTTATTAGACATCAAAACATCATA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCTTGGTAGTTCATTATTCCTTTTAACAGGTCGAAAATAATCTGTAGTTTTGTAGTAT / / / / / NlaIV BccI | | CviJI | | AluI | SetI TspEI K E P S S N K E N C P A F I R H Q N I I R N H Q V I R K I V Q L L L D I K T S * G T I K * * G K L S S F Y * T S K H H N ----:----|----:----|----:----|----:----|----:----|----:----| F S G D L L L S F Q G A K I L C * F M M L P V M L Y Y P F N D L K * * V D F C * L F W * T I L F I T W S K N S M L V D Y ApoI CviRI* TspEI | TspDTI Hpy178III* | MseI | | FatI \ \ \ \ \ \ ACTTCTCCCGATTTCTTGCGAAAAAATAATATAAAATTTAATAGAGTGGTGCAGTTCCAA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TGAAGAGGGCTAAAGAACGCTTTTTTATTATATTTTAAATTATCTCACCACGTCAAGGTT / / / / / / Hpy178III* | MseI | | NlaIII TspEI | TspDTI ApoI CviRI* T S P D F L R K N N I K F N R V V Q F Q L L P I S C E K I I * N L I E W C S S N F S R F L A K K * Y K I * * S G A V P T ----:----|----:----|----:----|----:----|----:----|----:----| V E G S K K R F F L I F N L L T T C N W L K E R N R A F F Y Y L I * Y L P A T G S R G I E Q S F I I Y F K I S H H L E L FatI CviRI* |CviAII || TatI || |NspI || |Csp6I || |NlaIII || ||RsaI || ||| BetI* || ||| BspMII* CviAII || ||| |HpaII | ApoI || ||| |Hpy178III* | TspEI || ||| || TsoI | EcoRI || ||| || TfiI | NlaIII TspDTI || ||| || HinfI MaeIII | | BsgI | MmeI || ||| || | TspEI | TspEI \ \ \ \ \ \\ \\\ \\ \ \ \ \ CATGAATTCATCATTACTTTCCCTTATTGCATGTACTCCGGATTCAATTATGGTTACAAT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| GTACTTAAGTAGTAATGAAAGGGAATAACGTACATGAGGCCTAAGTTAATACCAATGTTA // / / / / ///// /// / / / || EcoRI | MmeI | ||||| ||| | TspEI MaeIII || TspEI TspDTI | ||||| ||| HinfI || BsgI | ||||| ||| TfiI || ApoI | ||||| ||BspMII* |FatI | ||||| ||BetI* CviAII | ||||| |Hpy178III* | ||||| |HpaII | ||||| TsoI | ||||TatI | |||Csp6I | ||RsaI | |FatI | CviAII CviRI* NlaIII NspI H E F I I T F P Y C M Y S G F N Y G Y N M N S S L L S L I A C T P D S I M V T I * I H H Y F P L L H V L R I Q L W L Q F ----:----|----:----|----:----|----:----|----:----|----:----| C S N M M V K G * Q M Y E P N L * P * L V H I * * * K G K N C T S R I * N H N C M F E D N S E R I A H V G S E I I T V I MboI | DpnI | |BstKTI | || Cac8I TfiI | || | AluI SetI HinfI | || | CviJI |MseI | TspDTI | || | | SetI ||AhaIII* \ \ \ \\ \ \ \ \\\ TTTGGCGAATCTATTGAGTTCATATTAGATCAGCAAGCTGTCGTTAGAAAGCAACCTTTA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| AAACCGCTTAGATAACTCAAGTATAATCTAGTCGTTCGACAGCAATCTTTCGTTGGAAAT / / / // / / / / // TspEI | HinfI || | | CviJI SetI |MseI | TfiI || | | AluI AhaIII* TspDTI || | Cac8I || | SetI || MboI |DpnI BstKTI F G E S I E F I L D Q Q A V V R K Q P L L A N L L S S Y * I S K L S L E S N L * W R I Y * V H I R S A S C R * K A T F K ----:----|----:----|----:----|----:----|----:----|----:----| K P S D I S N M N S * C A T T L F C G K N Q R I * Q T * I L D A L Q R * F A V K K A F R N L E Y * I L L S D N S L L R * AciI TspGWI |BisI Hin4II* | MboII ApoI ||BlsI | Hin4I | | AsuI* TspEI |||TauI | |SapI | | AvaII Hin4I |||CviJI | |Ksp632I* | | |BmgT120I | MmeI \\\\ \ \\ \ \ \\ \ \ AAATGCGGCTGTGGAAACAAGAAGGAAGAGCGAAAATCTGGTCCGTTTTCAAATTTATCT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TTTACGCCGACACCTTTGTTCTTCCTTCTCGCTTTTAGACCAGGCAAAAGTTTAAATAGA //// / / / / // / // |||CviJI Hin4II* | | MboII || Hin4I |TspEI ||BisI Hin4I | TspGWI |AvaII |ApoI ||AciI Ksp632I* |AsuI* MmeI |BlsI SapI BmgT120I TauI K C G C G N K K E E R K S G P F S N L S N A A V E T R R K S E N L V R F Q I Y L M R L W K Q E G R A K I W S V F K F I L ----:----|----:----|----:----|----:----|----:----|----:----| F H P Q P F L F S S R F D P G N E F K D L I R S H F C S P L A F I Q D T K L N I F A A T S V L L F L S F R T R K * I * R HinfI | Hpy188I | |MnlI TfiI | || PleI CviJI HinfI | || |MlyI |NlaIV \ \ \\ \\ \\ TATGATTCTAATGAGTCGGAGCAACGAGGCTCCATTACTGATAATGATAACGATTTATTT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| ATACTAAGATTACTCAGCCTCGTTGCTCCGAGGTAATGACTATTACTATTGCTAAATAAA / /// / // HinfI ||| PleI |NlaIV TfiI ||| MlyI CviJI ||MnlI |Hpy188I HinfI Y D S N E S E Q R G S I T D N D N D L F M I L M S R S N E A P L L I M I T I Y F * F * * V G A T R L H Y * * * * R F I S ----:----|----:----|----:----|----:----|----:----|----:----| * S E L S D S C R P E M V S L S L S K N K H N * H T P A V L S W * Q Y H Y R N I I I R I L R L L S A G N S I I I V I * K TspDTI | SmlI | | Hpy178III* TaqI TspEI | | | MaeIII ApoI AsuII | Bce83I* | | | |MnlI TspEI \ \ \ \ \ \ \\ \ CAAAAAGTTCGAAGTTTTGATGAATTACTAAACCATTCCTCTCAAGAGTTACAAAATTTA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTTTCAAGCTTCAAAACTACTTAATGATTTGGTAAGGAGAGTTCTCAATGTTTTAAAT / / / / / / / / / AsuII | TspEI TspDTI | MnlI | | TspEI TaqI Bce83I* | | | ApoI | | FalI | | FalI | MaeIII Hpy178III* SmlI Q K V R S F D E L L N H S S Q E L Q N L K K F E V L M N Y * T I P L K S Y K I * K S S K F * * I T K P F L S R V T K F R ----:----|----:----|----:----|----:----|----:----|----:----| * F T R L K S S N S F W E E * S N C F K E F L E F N Q H I V L G N R E L T V F N L F N S T K I F * * V M G R L L * L I * SspI | MseI | VspI MboII FalI BbvII* | |FalI TspDTI FalI | MboII | |FalI AciI |TaqII \ \ \ \ \\ \ \\ GAAGACAATAAGAACCCCTTGTTCTCCAATATTAATATGAACAGACCGCAAAGTAGTTCT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTGTTATTCTTGGGGAACAAGAGGTTATAATTATACTTGTCTGGCGTTTCATCAAGA / / / / / // BbvII* | | VspI | |MboII MboII | | MseI | |TaqII | SspI | TspDTI FalI AciI FalI E D N K N P L F S N I N M N R P Q S S S K T I R T P C S P I L I * T D R K V V L R Q * E P L V L Q Y * Y E Q T A K * F S ----:----|----:----|----:----|----:----|----:----|----:----| S S L L F G K N E L I L I F L G C L L E L L C Y S G R T R W Y * Y S C V A F Y N F V I L V G Q E G I N I H V S R L T T R AlwNI Hpy178III* | FatI | |CviAII Ksp632I* | || TfiI | AccI Hpy166II | || HinfI | |Hpy166II | BsrI | || NlaIII TspDTI \ \\ \ \ \ \\ \ \ CTTCGGTCTACTACCCCTAATGGTGTAAACCAGTTCCTGAACATGAATCAAACTACCATA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| GAAGCCAGATGATGGGGATTACCACATTTGGTCAAGGACTTGTACTTAGTTTGATGGTAT // // / / / // / / |AccI |BsrI | | | || HinfI TspDTI Ksp632I* | | | | || TfiI Hpy166II | | | | |FatI | | | | CviAII | | | NlaIII | | Hpy178III* | AlwNI Hpy166II L R S T T P N G V N Q F L N M N Q T T I F G L L P L M V * T S S * T * I K L P * S V Y Y P * W C K P V P E H E S N Y H K ----:----|----:----|----:----|----:----|----:----|----:----| R R D V V G L P T F W N R F M F * V V M E E T * * G * H H L G T G S C S D F * W K P R S G R I T Y V L E Q V H I L S G Y MboII | ApoI | TspEI CspCI | | XmnI BccI | BseGI FokI SspI NlaIV \ \ \ \ \ \ \ \ \ AGCAGAATTTCTTCCCCGTTGTTATCAAGGATGATGGACTTATCAAATATTGTGGAACCC 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TCGTCTTAAAGAAGGGGCAACAATAGTTCCTACTACCTGAATAGTTTATAACACCTTGGG / / / / / / / / MboII TspEI | | BseGI | SspI NlaIV XmnI | CspCI FokI ApoI BccI S R I S S P L L S R M M D L S N I V E P A E F L P R C Y Q G * W T Y Q I L W N P Q N F F P V V I K D D G L I K Y C G T H ----:----|----:----|----:----|----:----|----:----|----:----| L L I E E G N N D L I I S K D F I T S G L C F K K G T T I L S S P S I L Y Q P V A S N R G R Q * * P H H V * * I N H F G BinI* | CspCI | | MboI | | | DpnI | | | |BssKI | | | |BseGI | | | |BstKTI | | | ||HpaII AciI | | | |||ScrFI | TspEI | | | |||CauII* | | MwoI | | | |||| NlaIV | | |AciI | | | |||| |FokI MseI | | || TspGWI \ \ \ \\\\ \\ \ \ \ \\ \ ACTTTGGATGATCCGGGTTCCAAGTTCAAAAGGAAAGTTTTAACTCCGCAATTACCGCAG 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TGAAACCTACTAGGCCCAAGGTTCAAGTTTTCCTTTCAAAATTGAGGCGTTAATGGCGTC / // / / // / / / / / / | || | | || FokI MseI | | | TspGWI | || | | |NlaIV | | | AciI | || | | BssKI | | TspEI | || | CauII* | MwoI | || | HpaII AciI | || | ScrFI | || MboI | |DpnI | BstKTI | BseGI CspCI BinI* T L D D P G S K F K R K V L T P Q L P Q L W M I R V P S S K G K F * L R N Y R R F G * S G F Q V Q K E S F N S A I T A D ----:----|----:----|----:----|----:----|----:----|----:----| V K S S G P E L N L L F T K V G C N G C W K P H D P N W T * F S L K L E A I V A S Q I I R T G L E F P F N * S R L * R L TspEI |TspDTI || MaeI HgiCI* SspI || | TspEI | NlaIV Hin4II* \ \\ \ \ \ \ \ ATGAATATTCCGTCTAATTCTAGTAATTTTGGCACCCCTTCTCTAACTAATACAAACTCC 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTATAAGGCAGATTAAGATCATTAAAACCGTGGGGAAGAGATTGATTATGTTTGAGG / / / / / / / / SspI | | MaeI | | HgiCI* Hin4II* | TspEI | NlaIV TspDTI TspEI M N I P S N S S N F G T P S L T N T N S * I F R L I L V I L A P L L * L I Q T P E Y S V * F * * F W H P F S N * Y K L L ----:----|----:----|----:----|----:----|----:----|----:----| I F I G D L E L L K P V G E R V L V F E S S Y E T * N * Y N Q C G K E L * Y L S H I N R R I R T I K A G R R * S I C V G TseI |BisI BceAI ||BlsI CviJI | TaqI BccI |||CviJI \ \ \ \ \\\\ TTACTATCTAATATAACGGCTACATCAACCAACCCATCGACAACTACAAATGGCAGCCAA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| AATGATAGATTATATTGCCGATGTAGTTGGTTGGGTAGCTGTTGATGTTTACCGTCGGTT / / / / /// CviJI | | BccI ||CviJI | TaqI ||TseI BceAI |BisI BlsI L L S N I T A T S T N P S T T T N G S Q Y Y L I * R L H Q P T H R Q L Q M A A K T I * Y N G Y I N Q P I D N Y K W Q P K ----:----|----:----|----:----|----:----|----:----|----:----| K S D L I V A V D V L G D V V V F P L W R V I * Y L P * M L W G M S L * L H C G * * R I Y R S C * G V W R C S C I A A L SetI |SfeI* || TseI || CviRI* || |BisI || ||BlsI || ||PstI || |||CviJI || ||||AciI MseI || ||||BisI |HpaI || |||||BlsI BbvI |HindII || |||||MnlI BbvI | MslI |Hpy166II MseI || ||||||TauI | SfaNI \ \ \\ \ \\ \\\\\\\ \ \ AACCACAATAATGTTAACGCCAATGGCATTAACACCTCTGCAGCCGCATCTATCAATAAT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TTGGTGTTATTACAATTGCGGTTACCGTAATTGTGGAGACGTCGGCGTAGATAGTTATTA // // / / / /////// / / |BbvI |MseI | SetI | ||||||AciI | SfaNI MslI Hpy166II MseI | |||||BisI BbvI HindII | ||||MnlI HpaI | ||||BlsI | |||CviJI | |||TseI | |||TauI | ||SfeI* | ||BisI | |BlsI | CviRI* PstI N H N N V N A N G I N T S A A A S I N N T T I M L T P M A L T P L Q P H L S I I P Q * C * R Q W H * H L C S R I Y Q * * ----:----|----:----|----:----|----:----|----:----|----:----| F W L L T L A L P M L V E A A A D I L L F G C Y H * R W H C * C R Q L R M * * Y V V I I N V G I A N V G R C G C R D I I Hin6I |GlaI AclI |Eco47III MaeII Csp6I ||HhaI | SetI MboII |RsaI |||HaeII | TaiI |Tsp4CI* \\ \\\\ \ \ \\ AACATTAGCAGTACCAATAATAGCGCTAATAATAGTAGTAGTAATAATAACGTTTCCACT 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTAATCGTCATGGTTATTATCGCGATTATTATCATCATCATTATTATTGCAAAGGTGA // //// / / / // |Csp6I |||Hin6I | | | |Tsp4CI* RsaI ||Eco47III | | | MboII ||GlaI | | TspRI |HhaI | MaeII HaeII | AclI TaiI SetI N I S S T N N S A N N S S S N N N V S T T L A V P I I A L I I V V V I I T F P L H * Q Y Q * * R * * * * * * * * R F H C ----:----|----:----|----:----|----:----|----:----|----:----| L M L L V L L L A L L L L L L L L T E V Y C * C Y W Y Y R * Y Y Y Y Y Y Y R K W V N A T G I I A S I I T T T I I V N G S Hin4II* | BsmI | CviRI* | | EcoT22I Eam1105I | | | Eco57I | SetI | | | Eco57MI | |MaeI | | | Hpy166II | || BslFI | | | | Hin4I | || | AciI | | | | Hin4I | || | |BisI TspRI | | | | |MseI | || | ||BlsI | SfaNI | | | | ||AhaIII* | || | |||TauI \ \ \ \ \ \ \\\ \ \\ \ \\\\ GTGCCTTCTTCAATGATGCATTCGTCCACTTTAAATGGGACTTCAGGTCTAGGCGGCGAT 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| CACGGAAGAAGTTACTACGTAAGCAGGTGAAATTTACCCTGAAGTCCAGATCCGCCGCTA / / / / /// // // / /// / | | | | ||| |MseI |SetI | ||| Hin4I | | | | ||| AhaIII* | | ||| Hin4I | | | | ||Hpy166II | | ||BslFI | | | | |Hin4I | | ||BisI | | | | |Hin4I | | ||AciI | | | | Eco57MI | | |BlsI | | | | Eco57I | | TauI | | | CviRI* | MaeI | | EcoT22I Eam1105I | | BsmI | Hin4II* SfaNI V P S S M M H S S T L N G T S G L G G D C L L Q * C I R P L * M G L Q V * A A I A F F N D A F V H F K W D F R S R R R * ----:----|----:----|----:----|----:----|----:----|----:----| T G E E I I C E D V K F P V E P R P P S Q A K K L S A N T W K L H S K L D L R R H R R * H H M R G S * I P S * T * A A I MwoI | CviJI | |BsrI | |TspRI | || HgaI | || | MwoI | || | |Hin6I | || | ||GlaI AluI | || | ||Eco47III CviJI | || | |||HhaI Hin4I | SetI | || | ||||HphI MaeIII Hin4I | |MseI TsoI | || | ||||HaeII Tsp45I \ \ \\ \ \ \\ \ \\\\\ \ AACGATGACAATATGTTAGCTTTAAGTTTAGCGACACTGGCTAACAGCGCTACTGCGTCA 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCTACTGTTATACAATCGAAATTCAAATCGCTGTGACCGATTGTCGCGATGACGCAGT / / / / / / // / //// | | | TsoI | MwoI || | |||Hin6I | | MseI TspRI || | |||HgaI | CviJI || | |||HphI | AluI || | ||Eco47III SetI || | ||GlaI || | |HhaI || | HaeII || MwoI |CviJI BsrI N D D N M L A L S L A T L A N S A T A S T M T I C * L * V * R H W L T A L L R H R * Q Y V S F K F S D T G * Q R Y C V T ----:----|----:----|----:----|----:----|----:----|----:----| L S S L I N A K L K A V S A L L A V A D Y R H C Y T L K L N L S V P * C R * Q T V I V I H * S * T * R C Q S V A S S R * MaeII |MaeIII || SetI || TaiI || | AciI || | | AciI TfiI || | | BisI HinfI || | | |HphI | Hpy188I || | | |BlsI | | CfrI || | | ||TauI | | | CviJI || | | ||NspBII* | | | HaeIII || | | ||| MaeIII | | | | TspDTI || | | ||| Tsp45I | | | | | SetI BceAI \\ \ \ \\\ \ \ \ \ \ \ \ \ CCAAGATTGACGTTACCGCCGCTGTCGTCACCAATGAATCCGAACGGCCACACCTCATAT 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTCTAACTGCAATGGCGGCGACAGCAGTGGTTACTTAGGCTTGCCGGTGTGGAGTATA / / / / //// / // / / / Tsp45I | | | |||NspBII* Tsp45I || | | SetI MaeIII | | | |||AciI MaeIII || | CfrI | | | ||BisI || TspDTI | | | |BlsI || HaeIII | | | |HphI || CviJI | | | AciI |Hpy188I | | | TauI HinfI | | MaeIII TfiI | MaeII TaiI SetI P R L T L P P L S S P M N P N G H T S Y Q D * R Y R R C R H Q * I R T A T P H I K I D V T A A V V T N E S E R P H L I * ----:----|----:----|----:----|----:----|----:----|----:----| G L N V N G G S D D G I F G F P W V E Y V L I S T V A A T T V L S D S R G C R M W S Q R * R R Q R * W H I R V A V G * I CspCI | Tsp4CI* | | EcoP15I Tsp4CI* | | | AluI MnlI | TspDTI | | | CviJI | CspCI | | TspRI | |MwoI | | SetI \ \ \ \ \ \ \\ \ \ \ AATGGCAATATGATGAACAACAACAGTGGTAATGGTAGCAACGGTAGCAACAGCTATTCT 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TTACCGTTATACTACTTGTTGTTGTCACCATTACCATCGTTGCCATCGTTGTCGATAAGA / / / / / / // / / | CspCI | | TspDTI | |Tsp4CI* | CviJI BceAI | Tsp4CI* | MwoI | AluI MnlI TspRI CspCI EcoP15I SetI N G N M M N N N S G N G S N G S N S Y S M A I * * T T T V V M V A T V A T A I L W Q Y D E Q Q Q W * W * Q R * Q Q L F * ----:----|----:----|----:----|----:----|----:----|----:----| L P L I I F L L L P L P L L P L L L * E Y H C Y S S C C C H Y H Y C R Y C C S N I A I H H V V V T T I T A V T A V A I R BceAI TseI | TstI CviJI | | Hin6I BbvI |BisI | | |GlaI |Tsp4CI* ||BlsI | | ||HhaI || BbvI |||TseI | | |||HaeII || MaeIII ||||BisI | | |||| BslFI || Tsp45I |||||BlsI | | |||| | MnlI \\ \ \\\\\\ \ \ \\\\ \ \ AACGGTGTGACTACGGCTGCTGCCACAACTACATCAGCGCCTCACAATCTATCCATAGTG 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCCACACTGATGCCGACGACGGTGTTGATGTAGTCGCGGAGTGTTAGATAGGTATCAC / / // /////// / / //// / | | || ||||||TseI | | |||Hin6I BslFI | | || |||||BisI | | ||GlaI MnlI | | || ||||BlsI | | |HhaI | | || |||TseI | | HaeII | | || ||BisI | BceAI | | || |BlsI TstI | | || CviJI | | |Tsp45I | | |MaeIII | | BbvI | BbvI Tsp4CI* N G V T T A A A T T T S A P H N L S I V T V * L R L L P Q L H Q R L T I Y P * C R C D Y G C C H N Y I S A S Q S I H S V ----:----|----:----|----:----|----:----|----:----|----:----| L P T V V A A A V V V D A G * L R D M T * R H S * P Q Q W L * M L A E C D I W L V T H S R S S G C S C * R R V I * G Y H Tsp4CI* | Hpy188I | |TfiI TstI | |HinfI MmeI \ \ \\ \ TCCCCTAATCCAACATACAGTCCGAATCCCCTATCTCTTTATTTGACCAACTCCAAAAAT 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| AGGGGATTAGGTTGTATGTCAGGCTTAGGGGATAGAGAAATAAACTGGTTGAGGTTTTTA / / / / / TstI | | | MmeI | | HinfI | | TfiI | Hpy188I Tsp4CI* S P N P T Y S P N P L S L Y L T N S K N P L I Q H T V R I P Y L F I * P T P K I P * S N I Q S E S P I S L F D Q L Q K S ----:----|----:----|----:----|----:----|----:----|----:----| D G L G V Y L G F G R D R * K V L E L F T G * D L M C D S D G I E K N S W S W F G R I W C V T R I G * R K I Q G V G F I MseI SetI Bce83I* MnlI | ApoI | CviRI* FokI |Hin4II* | SmlI | TspEI | |HphI | SetI || BseGI | | Hpy178III* \ \ \ \\ \ \ \\ \ \ \ \ CCATTAAATTCAGGTCTTGCACCCTTATCACCTTCAACATCTAACATCCCATTTCTCAAG 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| GGTAATTTAAGTCCAGAACGTGGGAATAGTGGAAGTTGTAGATTGTAGGGTAAAGAGTTC / // / / / / / / / / | |SetI CviRI* SetI | | | BseGI MnlI Hpy178III* | TspEI HphI | | Hin4II* SmlI | ApoI | Bce83I* TsoI MseI FokI P L N S G L A P L S P S T S N I P F L K H * I Q V L H P Y H L Q H L T S H F S R I K F R S C T L I T F N I * H P I S Q E ----:----|----:----|----:----|----:----|----:----|----:----| G N F E P R A G K D G E V D L M G N R L D M L N L D Q V R I V K L M * C G M E * W * I * T K C G * * R * C R V D W K E L MboII Hpy178III* CviJI MseI | HindIII | SduI | FalI | | AluI | HgiJII* | FalI | | CviJI | | FalI TsoI MaeIII | | SspI | | | SetI | | FalI \ \ \ \ \ \ \ \ \ \ \ \ AGGAATAATGTGGTTACATTAAATATTTCAAGAGAAGCTTCAAAGAGCCCTATATCTTCT 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| TCCTTATTACACCAATGTAATTTATAAAGTTCTCTTCGAAGTTTCTCGGGATATAGAAGA // / / / / / / //// / || | SspI | | | | |||FalI Hin4I || MseI | | | | |||FalI Hin4I |MaeIII | | | | ||CviJI FalI | | | | |MboII FalI | | | | HgiJII* | | | | SduI | | | HindIII | | CviJI | | AluI | SetI Hpy178III* R N N V V T L N I S R E A S K S P I S S G I M W L H * I F Q E K L Q R A L Y L L E * C G Y I K Y F K R S F K E P Y I F F ----:----|----:----|----:----|----:----|----:----|----:----| L F L T T V N F I E L S A E F L G I D E S S Y H P * M L Y K L L L K L S G * I K P I I H N C * I N * S F S * L A R Y R R TspGWI |SfeI* || MboI || TaqII || BglII FatI || XhoII MboII Hin4I || | DpnI Hin4I |CviAII Hin4I || | |BstKTI Hin4I || NlaIII \ \\ \ \\ \ \\ \ TTTGTAAATGACTATAGATCTCCGTTGGGTGTAAGCAATCCACTCATGTATTCTTCCACA 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| AAACATTTACTGATATCTAGAGGCAACCCACATTCGTTAGGTGAGTACATAAGAAGGTGT / / /// / / // // | | ||| XhoII Hin4I || |FatI | | ||| BglII Hin4I || CviAII | | ||| MboI |NlaIII | | ||DpnI MboII | | |BstKTI | | SfeI* | TaqII TspGWI F V N D Y R S P L G V S N P L M Y S S T L * M T I D L R W V * A I H S C I L P Q C K * L * I S V G C K Q S T H V F F H N ----:----|----:----|----:----|----:----|----:----|----:----| K T F S * L D G N P T L L G S M Y E E V K Q L H S Y I E T P H L C D V * T N K W K Y I V I S R R Q T Y A I W E H I R G C SspI Tsp4CI* | MseI | ApoI | VspI | TspEI | |SfaNI |Csp6I EcoRI | || BspMI ||RsaI |BsrI | || | DdeI \\\ \\ \ \\ \ \ ATCAACGATTATTCAAACGGTACTGGAATTCGCCAAAATAGTAATAATATTAATCCCTTA 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTTGCTAATAAGTTTGCCATGACCTTAAGCGGTTTTATCATTATTATAATTAGGGAAT / // / / / / / // | || BsrI EcoRI | | | |DdeI | |Csp6I TspEI | | | BspMI | RsaI ApoI | | SfaNI Tsp4CI* | VspI | MseI SspI I N D Y S N G T G I R Q N S N N I N P L S T I I Q T V L E F A K I V I I L I P * Q R L F K R Y W N S P K * * * Y * S L R ----:----|----:----|----:----|----:----|----:----|----:----| I L S * E F P V P I R W F L L L I L G K L * R N N L R Y Q F E G F Y Y Y Y * D R D V I I * V T S S N A L I T I I N I G * CviRI* | AsuI* | AvaII | |BmgT120I | ||SetI | ||| BseRI BccI MnlI Tsp4CI* \ \\\ \ \ \ \ GATGCAGGTCCATCTTTTTCTCCTCTCCACAAAAAACCCAAAATACTCAACGGTAATGAT 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| CTACGTCCAGGTAGAAAAAGAGGAGAGGTGTTTTTTGGGTTTTATGAGTTGCCATTACTA // // / / / || |AvaII BccI MnlI Tsp4CI* || |AsuI* || BmgT120I || BseRI |SetI CviRI* D A G P S F S P L H K K P K I L N G N D M Q V H L F L L S T K N P K Y S T V M I C R S I F F S S P Q K T Q N T Q R * * * ----:----|----:----|----:----|----:----|----:----|----:----| S A P G D K E G R W L F G L I S L P L S L H L D M K K E E G C F V W F V * R Y H I C T W R K R R E V F F G F Y E V T I I Hpy178III* | Tsp4CI* TfiI | | TspEI Tsp4CI* MaeIII HinfI \ \ \ \ \ \ AATAGCAATCTGGACAGTAATAATTTTGATTACAGTTTCACGGGTAACAAGCAAGAATCT 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| TTATCGTTAGACCTGTCATTATTAAAACTAATGTCAAAGTGCCCATTGTTCGTTCTTAGA / / / / / / | Tsp4CI* TspEI Tsp4CI* MaeIII HinfI Hpy178III* TfiI N S N L D S N N F D Y S F T G N K Q E S I A I W T V I I L I T V S R V T S K N L * Q S G Q * * F * L Q F H G * Q A R I * ----:----|----:----|----:----|----:----|----:----|----:----| L L L R S L L L K S * L K V P L L C S D Y Y C D P C Y Y N Q N C N * P Y C A L I I A I Q V T I I K I V T E R T V L L F R BsaBI | MboII BccI | | Csp6I Hpy178III* | | |RsaI \ \ \ \\ AATCCATCAATCTTGAACAATAATACTAATAATAATGATAACTATCGTACATCTTCAATG 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| TTAGGTAGTTAGAACTTGTTATTATGATTATTATTACTATTGATAGCATGTAGAAGTTAC // / / // |Hpy178III* | | |Csp6I BccI | | RsaI | MboII BsaBI N P S I L N N N T N N N D N Y R T S S M I H Q S * T I I L I I M I T I V H L Q * S I N L E Q * Y * * * * * L S Y I F N E ----:----|----:----|----:----|----:----|----:----|----:----| L G D I K F L L V L L L S L * R V D E I * D M L R S C Y Y * Y Y H Y S D Y M K L I W * D Q V I I S I I I I V I T C R * H MboII |BceAI ||Hin6I |||GlaI TspDTI ||||BsmI HphI | TspEI ||||HhaI DdeI MnlI |SetI \ \ \\\\\ \ \ \\ AACAATAACGGCAACAATTATCAAGCGCATTCTTCTAAGTTCGGTGAAAATGAGGTCATT 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTTATTGCCGTTGTTAATAGTTCGCGTAAGAAGATTCAAGCCACTTTTACTCCAGTAA / / / /// / / / / TspDTI | | ||Hin6I DdeI MnlI | HphI | | |BceAI SetI | | |GlaI | | HhaI | | BsmI | MboII TspEI N N N G N N Y Q A H S S K F G E N E V I T I T A T I I K R I L L S S V K M R S L Q * R Q Q L S S A F F * V R * K * G H Y ----:----|----:----|----:----|----:----|----:----|----:----| F L L P L L * * A C E E L N P S F S T M S C Y R C C N D L A N K * T R H F H P * V I V A V I I L R M R R L E T F I L D N MboI Hpy188I | DpnI | |FatI | |BstKTI MaeIII | ||CviAII Tsp4CI* Tsp45I | ||| NlaIII Hpy178III* | HphI BstEII \ \\\ \ \ \ \ \ ATGTCAGATCATGGTAAGATTTACATTTGTCGGGAATGTAATAGACAGTTTTCCTCTGGT 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGTCTAGTACCATTCTAAATGTAAACAGCCCTTACATTATCTGTCAAAAGGAGACCA / //// // / / / | |||| |FatI Hpy178III* | HphI | |||| CviAII Tsp4CI* | |||MboI | ||NlaIII | |DpnI | BstKTI Hpy188I M S D H G K I Y I C R E C N R Q F S S G C Q I M V R F T F V G N V I D S F P L V V R S W * D L H L S G M * * T V F L W S ----:----|----:----|----:----|----:----|----:----|----:----| I D S * P L I * M Q R S H L L C N E E P * T L D H Y S K C K D P I Y Y V T K R Q H * I M T L N V N T P F T I S L K G R T BetI* |MslI HphI MnlI BccI TspDTI |HpaII | SfaNI \ \ \ \\ \ \ CACCATCTAACAAGACATAAAAAGTCAGTTCATTCCGGTGAGAAACCCCATTCTTGCCCA 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| GTGGTAGATTGTTCTGTATTTTTCAGTCAAGTAAGGCCACTCTTTGGGGTAAGAACGGGT // / / / // / / / |BstEII BccI TspDTI | |BetI* HphI | MwoI |Tsp45I | HpaII SfaNI |MaeIII MslI MnlI H H L T R H K K S V H S G E K P H S C P T I * Q D I K S Q F I P V R N P I L A Q P S N K T * K V S S F R * E T P F L P K ----:----|----:----|----:----|----:----|----:----|----:----| * W R V L C L F D T * E P S F G W E Q G D G D L L V Y F T L E N R H S V G N K G V M * C S M F L * N M G T L F G M R A W TfiI MseI HinfI |SwaI | PpiI FatI |AhaIII* | |Ksp632I* |CviAII || PpiI MwoI | |Hpy178III* || NlaIII || | Bce83I* | BsiYI* | || BsmAI || |MboII || | | ApoI | |AciI | || Eco31I || || CviRI* || | | TspEI \ \\ \ \\ \ \\ \\ \ \\ \ \ \ AGATGCGGTAAAAGATTCAAGAGAAGAGACCATGTTCTGCAACATTTAAATAAAAAAATT 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| TCTACGCCATTTTCTAAGTTCTCTTCTCTGGTACAAGACGTTGTAAATTTATTTTTTTAA / / / / // / / // / / // / / | AciI PpiI | || | | || | | || Bce83I* TspEI BsiYI* | || | | || | | |MseI ApoI | || | | || | | AhaIII* | || | | || | | SwaI | || | | || | PpiI | || | | || CviRI* | || | | |MboII | || | | |FatI | || | | CviAII | || | NlaIII | || Eco31I | || BsmAI | |Ksp632I* | Hpy178III* HinfI TfiI R C G K R F K R R D H V L Q H L N K K I D A V K D S R E E T M F C N I * I K K F M R * K I Q E K R P C S A T F K * K N S ----:----|----:----|----:----|----:----|----:----|----:----| L H P L L N L L L S W T R C C K F L F I L I R Y F I * S F L G H E A V N L Y F F S A T F S E L S S V M N Q L M * I F F N FatI |CviAII AluI || CviRI* CviJI || NlaIII | SetI || | SmlI | |TfiI || | | Hpy178III* TspEI | |HinfI \\ \ \ \ \ \ \\ CCATGCACTCAAGAAATGGAAAATACTAAATTAGCTGAATCATAG 2650 2660 2670 2680 ----:----|----:----|----:----|----:----|----: GGTACGTGAGTTCTTTACCTTTTATGATTTAATCGACTTAGTATC / // / / / / | |CviRI* Hpy178III* | CviJI HinfI | |FatI SmlI | AluI TfiI | CviAII TspEI NlaIII SetI P C T Q E M E N T K L A E S * H A L K K W K I L N * L N H X M H S R N G K Y * I S * I I X ----:----|----:----|----:----|----:----|----: G H V * S I S F V L N A S D Y E M C E L F P F Y * I L Q I M W A S L F H F I S F * S F * L # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 12 BspACI,SsiI AclI 1 Psp1406I AhaIII* 5 DraI AlfI 2 AluI 7 AluBI AlwNI 1 CaiI ApoI 13 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BbvI 4 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 10 Bce83I* 4 BpuEI BceAI 5 BetI* 3 BsaWI BglII 1 BinI* 1 AlwI,BspPI,AclWI BisI 9 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 9 BmgT120I 2 BsaBI 1 Bse8I,BseJI BseGI 3 BstF5I,BtsCI BseRI 1 BsgI 1 BsiYI* 4 Bsc4I,BseLI,BslI,AfiI BslFI 3 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI BsmI 2 BsaMI,Mva1269I,PctI BspMI 1 BfuAI,Acc36I,BveI BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrI 5 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 4 BtgZI 2 BtsI 1 Cac8I 1 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I CfrI 2 AcoI,EaeI Csp6I 5 CviQI,RsaNI CspCI 2 CviAII 9 CviJI 22 CviKI-1 CviRI* 12 HpyCH4V DdeI 2 BstDEI,HpyF3I DpnI 4 MalI DsaI* 1 BtgI,BstDSI Eam1105I 2 AspEI,BmeRI,DriI,AhdI Eco31I 1 Bso31I,BspTNI,BsaI Eco47III 2 Aor51HI,AfeI Eco57I 1 AcuI Eco57MI 2 EcoP15I 2 EcoRI 2 EcoT22I 2 Mph1103I,NsiI,Zsp2I FalI 4 FatI 9 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 3 GlaI 4 GsuI 1 BpmI HaeII 3 BstH2I HaeIII 2 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 4 BstHHI,CfoI,AspLEI Hin4I 8 Hin4II* 5 HpyAV Hin6I 4 HinP1I,HspAI HindII 1 HincII HindIII 1 HinfI 14 HpaI 1 KspAI HpaII 4 HapII,BsiSI,MspI HphI 8 AsuHPI Hpy166II 5 Hpy8I Hpy178III* 13 Hpy188III Hpy188I 5 Ksp632I* 4 Eam1104I,EarI,Bst6I MaeI 4 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 12 MboI 4 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 12 MlyI 3 SchI MmeI 3 MnlI 12 MseI 18 Tru1I,Tru9I MslI 3 RseI,SmiMI MwoI 5 HpyF10VI,BstMWI NcoI 1 Bsp19I NlaIII 9 Hin1II,Hsp92II,FaeI NlaIV 5 BspLI,BmiI,PspN4I NspBII* 1 MspA1I NspI 1 BstNSI,XceI PflMI 3 BasI,AccB7I,Van91I PleI 3 PpsI PpiI 1 PstI 1 RsaI 5 AfaI SapI 1 LguI,PciSI,BspQI ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 1 BseDI,BssECI,BsaJI SetI 21 SfaNI 5 LweI SfeI* 2 BstSFI,SfcI,BfmI SmlI 4 SmoI SspI 6 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I SwaI 1 SmiI TaiI 2 TaqI 5 TaqII 2 TatI 1 TauI 5 TfiI 11 PfeI TseI 4 ApeKI TsoI 3 Tsp45I 4 NmuCI Tsp4CI* 15 HpyCH4III,TaaI,Bst4CI TspDTI 14 TspEI 29 TasI,Tsp509I,Sse9I TspGWI 3 TspRI 5 TscAI TstI 1 VspI 2 PshBI,AseI XbaI 1 XcmI 1 XhoII 1 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AcyI AflII AflIII AgeI AjuI AloI ApaI ApaLI AscI Asp718I AvaI AvrII BaeI BalI BamHI BarI BbvCI BcgI BciVI BclI BdaI BfiI BglI BmeT110I BmtI BplI Bpu10I BsaAI BsaXI BseBI BseMII BsePI BseSI BseYI BsiI* Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspOI BsrBI BsrDI BssNAI Bst1107I Bst2UI BstAPI BstNI BstOI BstXI BstZ17I BtrI Cfr10I Cfr9I ClaI DinI DraII DraIII DrdI EciI Ecl136II EcoICRI EcoNI EcoRII EcoRV EgeI EheI Esp3I EspI* FauI FseI FspAI GsaI Hpy99I KasI KpnI MauBI McrI* MfeI MluI MroNI MstI* MvaI NaeI NarI NdeI NgoMIV NheI NmeAIII NotI NruI OliI PacI PasI PfoI PmaCI PmeI PpuMI PshAI PsiI PspOMI PspXI PsrI PvuI PvuII RsrII SacI SacII SalI SanDI SauI* ScaI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI TspMI Tth111I XhoI XmaCI XmaI XmaIII* ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769