Restriction Map of PPH3/YDR075W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

PPH3/YDR075W on chromosome IV from coordinates 597156 to 598082.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.3577

BseMII |BspCNI || Esp3I || BsmAI || | DdeI || | | SfaNI Hpy178III* DdeI || | | |TspRI |TspGWI \ \\ \ \ \\ \\ ATGATGGACTTAGATAAGATTATAGCATCACTGAGAGACGGAAAACATATTCCTGAAGAA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTACCTGAATCTATTCTAATATCGTAGTGACTCTCTGCCTTTTGTATAAGGACTTCTT / // / // / / / DdeI || TspRI || SfaNI | Hpy178III* |BspCNI |DdeI TspGWI BseMII BsmAI Esp3I M M D L D K I I A S L R D G K H I P E E * W T * I R L * H H * E T E N I F L K K D G L R * D Y S I T E R R K T Y S * R N ----:----|----:----|----:----|----:----|----:----|----:----| X I S K S L I I A D S L S P F C I G S S X S P S L Y S * L M V S L R F V Y E Q L H H V * I L N Y C * Q S V S F M N R F F Tsp4CI* | MboII | |BsiYI* | || CviJI | || | Eco57I | || | Eco57MI MaeIII | || | | MseI |TspDTI | || | | |AhaIII* MseI || BsrDI | || | | ||ApoI VspI || | BaeI | || | | ||TspEI | Hin4II* || | TspDTI \ \\ \ \ \\\ \ \ \\ \ \ ACCGTTTTTAGGCTATGTTTAAATTCACAGGAACTATTAATGAATGAAGGCAATGTAACA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TGGCAAAAATCCGATACAAATTTAAGTGTCCTTGATAATTACTTACTTCCGTTACATTGT / // / // / / /// / / | |MboII Eco57MI || TspEI Hin4II* ||| | MaeIII | BsiYI* Eco57I || ApoI VspI ||| TspDTI Tsp4CI* CviJI |MseI MseI ||BsrDI AhaIII* |BaeI TspDTI T V F R L C L N S Q E L L M N E G N V T P F L G Y V * I H R N Y * * M K A M * H R F * A M F K F T G T I N E * R Q C N T ----:----|----:----|----:----|----:----|----:----|----:----| V T K L S H K F E C S S N I F S P L T V F R K * A I N L N V P V I L S H L C H L G N K P * T * I * L F * * H I F A I Y C BaeI | FatI | |CviAII | || CfrI | || |HphI AgeI | || |NlaIII BetI* | || ||BalI MboI Cfr10I | || ||CviJI | DpnI |HpaII | || ||HaeIII | |BstKTI TaqI || MaeIII AciI | || ||| TspEI | || MboII \ \\ \ \ \ \\ \\\ \ \ \\ \ CAAGTCGATACACCGGTTACAATATGCGGTGATATACATGGCCAATTACACGATCTACTA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCAGCTATGTGGCCAATGTTATACGCCACTATATGTACCGGTTAATGTGCTAGATGAT / // / // / /// / / // // TaqI || MaeIII |AciI | ||| | | || |MboII |Cfr10I BaeI | ||| | | || MboI |BetI* | ||| | | |DpnI |AgeI | ||| | | BstKTI HpaII | ||| | TspEI | ||| CfrI | ||HaeIII | ||CviJI | ||BalI | |FatI | CviAII | HphI NlaIII Q V D T P V T I C G D I H G Q L H D L L K S I H R L Q Y A V I Y M A N Y T I Y * S R Y T G Y N M R * Y T W P I T R S T N ----:----|----:----|----:----|----:----|----:----|----:----| C T S V G T V I H P S I C P W N C S R S V L R Y V P * L I R H Y V H G I V R D V L D I C R N C Y A T I Y M A L * V I * * TaqI AsuII | SapI | Ksp632I* SetI \ \ \ ACGCTCTTCGAAAAGAGTGGTGGTGTAGAGAAAACAAGGTATATTTTCTTGGGCGATTTT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TGCGAGAAGCTTTTCTCACCACCACATCTCTTTTGTTCCATATAAAAGAACCCGCTAAAA / / / | Ksp632I* SetI | SapI AsuII TaqI T L F E K S G G V E K T R Y I F L G D F R S S K R V V V * R K Q G I F S W A I L A L R K E W W C R E N K V Y F L G R F C ----:----|----:----|----:----|----:----|----:----|----:----| V S K S F L P P T S F V L Y I K K P S K L A R R F S H H H L S F L T Y K R P R N R E E F L T T T Y L F C P I N E Q A I K MaeIII | TspEI | | MseI \ \ \ GTGGATAGGGGATTTTACTCATTGGAGAGTTTTTTACTTTTACTATGTTACAAATTAAGA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CACCTATCCCCTAAAATGAGTAACCTCTCAAAAAATGAAAATGATACAATGTTTAATTCT / // | |MseI | TspEI MaeIII V D R G F Y S L E S F L L L L C Y K L R W I G D F T H W R V F Y F Y Y V T N * D G * G I L L I G E F F T F T M L Q I K I ----:----|----:----|----:----|----:----|----:----|----:----| T S L P N * E N S L K K S K S H * L N L Q P Y P I K S M P S N K V K V I N C I L H I P S K V * Q L T K * K * * T V F * S Hpy178III* | BssKI | | HpaII MnlI | | ScrFI AccI EcoRV MseI | | CauII* |BssNAI | Hpy178III* |TspEI | | | TspEI |Hpy166II \ \ \\ \ \ \ \ \\ TATCCTGATAGGATTACTTTAATTAGAGGCAATCACGAAACCCGGCAAATTACTAAAGTA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| ATAGGACTATCCTAATGAAATTAATCTCCGTTAGTGCTTTGGGCCGTTTAATGATTTCAT / / / / / / /// / / | Hpy178III* | | TspEI | ||BssKI TspEI Hpy166II EcoRV | MseI | |HpaII BssNAI MnlI | CauII* | ScrFI Hpy178III* Y P D R I T L I R G N H E T R Q I T K V I L I G L L * L E A I T K P G K L L K Y S * * D Y F N * R Q S R N P A N Y * S I ----:----|----:----|----:----|----:----|----:----|----:----| Y G S L I V K I L P L * S V R C I V L T I D Q Y S * K L * L C D R F G A F * * L I R I P N S * N S A I V F G P L N S F Y MaeIII | MnlI | MaeII | |BaeI Csp6I TspDTI | || SetI |RsaI TspGWI EcoP15I | || TaiI |SetI \ \ \ \\ \ \\ TACGGATTTTACGATGAAGTAGTAAGAAAATATGGTAATAGTAACGTATGGAGGTACTGC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| ATGCCTAAAATGCTACTTCATCATTCTTTTATACCATTATCATTGCATACCTCCATGACG / / / / / / // / // / AccI TspGWI | EcoP15I | | || | || Hin4I TspDTI | | || | || Hin4I | | || | |Csp6I | | || | RsaI | | || SetI | | |MaeII | | MaeIII | TaiI | SetI | MnlI BaeI Y G F Y D E V V R K Y G N S N V W R Y C T D F T M K * * E N M V I V T Y G G T A R I L R * S S K K I W * * * R M E V L L ----:----|----:----|----:----|----:----|----:----|----:----| Y P N * S S T T L F Y P L L L T H L Y Q I R I K R H L L L F I H Y Y Y R I S T S V S K V I F Y Y S F I T I T V Y P P V A Hin4I Hin4I Hin4I BaeI Hin4I TspDTI FatI \ \ \ \ \ TGTGAAGTTTTTGATTATTTATCATTGGGGGCAATAATAAACAATAGCATATTCTGTGTT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| ACACTTCAAAAACTAATAAATAGTAACCCCCGTTATTATTTGTTATCGTATAAGACACAA / / / / BaeI Hin4I TspDTI NlaIII Hin4I C E V F D Y L S L G A I I N N S I F C V V K F L I I Y H W G Q * * T I A Y S V F * S F * L F I I G G N N K Q * H I L C S ----:----|----:----|----:----|----:----|----:----|----:----| Q S T K S * K D N P A I I F L L M N Q T S H L K Q N N I M P P L L L C Y C I R H T F N K I I * * Q P C Y Y V I A Y E T N BetI* BspMII* |HpaII |Hpy178III* || SecI* CviAII || DsaI* | NlaIII || | Tsp4CI* TspDTI \ \ \\ \ \ \ CATGGTGGATTATCTCCGGATATGACCACGGTTGATGAAATACGAACAATAGACAGGAAA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GTACCACCTAATAGAGGCCTATACTGGTGCCAACTACTTTATGCTTGTTATCTGTCCTTT // // // / |FatI |BspMII* |DsaI* TspDTI CviAII |BetI* |SecI* Hpy178III* Tsp4CI* HpaII H G G L S P D M T T V D E I R T I D R K M V D Y L R I * P R L M K Y E Q * T G N W W I I S G Y D H G * * N T N N R Q E T ----:----|----:----|----:----|----:----|----:----|----:----| * P P N D G S I V V T S S I R V I S L F E H H I I E P Y S W P Q H F V F L L C S M T S * R R I H G R N I F Y S C Y V P F Hin4I Hin4II* Hin4I | FatI | MaeII | |CviAII | | SetI | || NlaIII | | TaiI | || BsiYI* MaeIII | | BbvII* | || |MslI Tsp45I | | |HindII | || || SetI |TspDTI | | |Hpy166II \ \\ \\ \ \\ \ \ \\ CAAGAAGTTCCACATGAAGGTGCTATGTGTGACTTATTATGGAGCGACCCCGAAGACGTT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCTTCAAGGTGTACTTCCACGATACACACTGAATAATACCTCGCTGGGGCTTCTGCAA / // /// / / / / / / | || ||MslI | Tsp45I Hin4I | | Hpy166II | || ||SetI | MaeIII Hin4I | | HindII | || |FatI TspDTI | MaeII | || CviAII TaiI | |BsiYI* SetI | NlaIII Hin4II* Q E V P H E G A M C D L L W S D P E D V K K F H M K V L C V T Y Y G A T P K T L R S S T * R C Y V * L I M E R P R R R * ----:----|----:----|----:----|----:----|----:----|----:----| C S T G C S P A I H S K N H L S G S S T V L L E V H L H * T H S I I S R G R L R L F N W M F T S H T V * * P A V G F V N FatI MboII |CviAII MboI ||Eam1105I Hin4I BclI ||| HphI Hin4I | DpnI ||| NlaIII MnlI | SetI | |BstKTI \\\ \ \ \ \ \ \\ GACACATGGTCATTATCACCAAGAGGTGCTGGATTTCTTTTCGGTAAAAGAGAAGTTGAT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTGTACCAGTAATAGTGGTTCTCCACGACCTAAAGAAAAGCCATTTTCTCTTCAACTA /// // / / / // ||| |FatI | | SetI |DpnI ||| CviAII | Hin4I BstKTI ||| HphI | Hin4I ||Eam1105I MnlI |NlaIII BbvII* MboII D T W S L S P R G A G F L F G K R E V D T H G H Y H Q E V L D F F S V K E K L I H M V I I T K R C W I S F R * K R S * S ----:----|----:----|----:----|----:----|----:----|----:----| S V H D N D G L P A P N R K P L L S T S Q C M T M I V L L H Q I E K R Y F L L Q V C P * * * W S T S S K K E T F S F N I AluI CviJI Ecl136II | SetI | SduI | SacI AclI | HgiAI* MaeII | HgiJII* TspEI | SetI MseI | | BccI | DdeI | TaiI |TspEI MaeI | | | Hin4II* \ \ \ \ \\ \ \ \ \ \ CAATTCTTAGAGAAAAACAACGTTGAGTTAATTGCTAGAGCTCATCAGTTAGTGATGGAA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GTTAAGAATCTCTTTTTGTTGCAACTCAATTAACGATCTCGAGTAGTCAATCACTACCTT / / / / / / / // / / / / | | DdeI | MaeII | | || Ecl136II | Hin4II* SetI | TspEI | AclI | | || CviJI BccI BclI TaiI | | || AluI MboI SetI | | |HgiJII* | | |HgiAI* | | |SacI | | |SduI | | |SetI | | MaeI | TspEI MseI Q F L E K N N V E L I A R A H Q L V M E N S * R K T T L S * L L E L I S * * W K I L R E K Q R * V N C * S S S V S D G R ----:----|----:----|----:----|----:----|----:----|----:----| * N K S F F L T S N I A L A * * N T I S D I R L S F C R Q T L Q * L E D T L S P L E * L F V V N L * N S S S M L * H H F MaeIII Tsp45I HgiCI* MaeIII Hpy99I | Tsp4CI* | NlaIV | SetI TaqI Tsp4CI* | | DrdI | | TspEI Tsp4CI* \ \ \ \ \ \ \ \ \ \ \ GGTTACAAAGAAATGTTCGACGGTGGATTAGTGACAGTCTGGTCGGCACCGAATTACTGT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CCAATGTTTCTTTACAAGCTGCCACCTAATCACTGTCAGACCAGCCGTGGCTTAATGACA / / / / / / / / / / MaeIII | | Tsp4CI* | DrdI | | | Tsp4CI* | TaqI Tsp4CI* | | TspEI Hpy99I Tsp45I | HgiCI* MaeIII NlaIV G Y K E M F D G G L V T V W S A P N Y C V T K K C S T V D * * Q S G R H R I T V L Q R N V R R W I S D S L V G T E L L L ----:----|----:----|----:----|----:----|----:----|----:----| P * L S I N S P P N T V T Q D A G F * Q L N C L F T R R H I L S L R T P V S N S T V F F H E V T S * H C D P R C R I V T TseI MboII |BisI |Hpy99I ||BlsI || BsaBI |||AluI || |TfiI |||CviJI || |HinfI |||PvuII || || Hpy178III* |||NspBII* || || | BdaI |||| SetI BbvI || || | BdaI \\\\ \ \ \\ \\ \ \ TATCGTTGTGGTAATGTAGCAGCTGTATTGAAGATAGACGACGATTTGAATCGTGAATAT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| ATAGCAACACCATTACATCGTCGACATAACTTCTATCTGCTGCTAAACTTAGCACTTATA /// / / / / / / / ||NspBII* | | MboII | | | BdaI ||PvuII | Hpy99I | | | BdaI ||CviJI BbvI | | Hpy178III* ||TseI | HinfI ||AluI | TfiI |BisI BsaBI BlsI SetI Y R C G N V A A V L K I D D D L N R E Y I V V V M * Q L Y * R * T T I * I V N I S L W * C S S C I E D R R R F E S * I Y ----:----|----:----|----:----|----:----|----:----|----:----| * R Q P L T A A T N F I S S S K F R S Y N D N H Y H L L Q I S S L R R N S D H I I T T T I Y C S Y Q L Y V V I Q I T F I AluI CviJI |XmnI ||MmeI Hpy188I ||SetI BdaI | TspDTI TspEI ||| MwoI BdaI | | TspEI \ \\\ \ \ \ \ \ ACAATTTTTGAAGCTGTTCAGGCACAAAATGAAGTCGGAAATGCTATAATTCCAACCAAA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTAAAAACTTCGACAAGTCCGTGTTTTACTTCAGCCTTTACGATATTAAGGTTGGTTT / / // / / / / / | | || MwoI BdaI | TspDTI TspEI | | |XmnI BdaI Hpy188I | | CviJI | | AluI | | MmeI | SetI TspEI T I F E A V Q A Q N E V G N A I I P T K Q F L K L F R H K M K S E M L * F Q P K N F * S C S G T K * S R K C Y N S N Q K ----:----|----:----|----:----|----:----|----:----|----:----| V I K S A T * A C F S T P F A I I G V L Y L K Q L Q E P V F H L R F H * L E L W C N K F S N L C L I F D S I S Y N W G F MmeI PsiI \ \ AAATCTCAAATGGACTATTTCTTATAA 910 920 ----:----|----:----|----:-- TTTAGAGTTTACCTGATAAAGAATATT / / MmeI PsiI K S Q M D Y F L * N L K W T I S Y X I S N G L F L I X ----:----|----:----|----:-- F D * I S * K K Y F I E F P S N R I F R L H V I E * L # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 1 BspACI,SsiI AclI 1 Psp1406I AgeI 1 AsiGI,BshTI,CspAI,PinAI AhaIII* 1 DraI AluI 3 AluBI ApoI 1 AcsI,XapI AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI BaeI 2 BalI 1 MlsI,MluNI,MscI,Msp20I BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 1 BclI 1 FbaI,Ksp22I BdaI 2 BetI* 2 BsaWI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BsaBI 1 Bse8I,BseJI BseMII 1 BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BsmAI 1 Alw26I,BstMAI BspCNI 1 BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrDI 1 BseMI,Bse3DI BssKI 1 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstKTI 2 CauII* 1 BcnI,BpuMI,NciI,AsuC2I Cfr10I 1 BsrFI,BssAI,Bse118I CfrI 1 AcoI,EaeI Csp6I 1 CviQI,RsaNI CviAII 4 CviJI 5 CviKI-1 DdeI 3 BstDEI,HpyF3I DpnI 2 MalI DrdI 1 AasI,DseDI DsaI* 1 BtgI,BstDSI Eam1105I 1 AspEI,BmeRI,DriI,AhdI Ecl136II 1 EcoICRI Eco57I 1 AcuI Eco57MI 1 EcoP15I 1 EcoRV 1 Eco32I Esp3I 1 BsmBI FatI 4 HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII Hin4I 4 Hin4II* 3 HpyAV HindII 1 HincII HinfI 1 HpaII 3 HapII,BsiSI,MspI HphI 2 AsuHPI Hpy166II 2 Hpy8I Hpy178III* 5 Hpy188III Hpy188I 1 Hpy99I 2 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 1 FspBI,BfaI,XspI MaeII 3 HpyCH4IV MaeIII 7 MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 4 MmeI 2 MnlI 3 MseI 5 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 1 HpyF10VI,BstMWI NlaIII 4 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I NspBII* 1 MspA1I PsiI 1 AanI PvuII 1 RsaI 1 AfaI SacI 1 Psp124BI,SstI SapI 1 LguI,PciSI,BspQI ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 1 BseDI,BssECI,BsaJI SetI 11 SfaNI 1 LweI TaiI 3 TaqI 3 TfiI 1 PfeI TseI 1 ApeKI Tsp45I 2 NmuCI Tsp4CI* 5 HpyCH4III,TaaI,Bst4CI TspDTI 7 TspEI 10 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 1 TscAI VspI 1 PshBI,AseI XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AcyI AflII AflIII AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuI* AvaI AvaII AvrII BamHI BarI BbvCI Bce83I* BceAI BcgI BciVI BfiI BglI BglII BinI* BmeT110I BmgT120I BmtI BplI Bpu10I BsaAI BsaXI BseBI BseGI BsePI BseRI BseSI BseYI BsgI BsiI* BslFI BsmFI BsmI Bsp120I Bsp1407I BspHI BspLU11I* BspMI BspOI BsrBI BsrI Bst2UI BstAPI BstEII BstF5I BstNI BstOI BstXI BtgZI BtrI BtsCI BtsI Cac8I Cfr9I ClaI CspCI CviRI* DinI DraII DraIII EciI Eco31I Eco47III EcoNI EcoRI EcoRII EcoT22I EgeI EheI EspI* FalI FaqI FauI FnuDII* FokI FseI FspAI GlaI GsaI GsuI HaeII HgaI HhaI Hin6I HindIII HinP1I HpaI HspAI KasI KpnI MauBI McrI* MfeI MluI MlyI Mph1103I MroNI MstI* MvaI NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspI OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PspOMI PspXI PsrI PstI PvuI RsrII SacII SalI SanDI SauI* ScaI SchI SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyI SwaI TaqII TatI TauI TsoI TspMI TstI Tth111I XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769