Restriction Map of PHO2/YDL106C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

PHO2/YDL106C on chromosome IV from coordinates 271901 to 270222.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.12927

EMBOSS_001 SplI* |Csp6I ||RsaI ||MboII ||| MboI ||| | DpnI ApoI ||| | |BstKTI TspEI ||| | ||Hpy178III* EcoRI ||| | ||| MseI SfeI* \ \\\ \ \\\ \ \ ATGATGGAAGAATTCTCGTACGATCACGATTTTAACACACATTTTGCTACAGATTTGGAT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTACCTTCTTAAGAGCATGCTAGTGCTAAAATTGTGTGTAAAACGATGTCTAAACCTA / ////// / / / / | |||||| | | MseI SfeI* | |||||| | Hpy178III* | |||||| MboI | |||||DpnI | ||||BstKTI | |||SplI* | ||Csp6I | |RsaI | MboII EcoRI TspEI ApoI M M E E F S Y D H D F N T H F A T D L D * W K N S R T I T I L T H I L L Q I W I D G R I L V R S R F * H T F C Y R F G L ----:----|----:----|----:----|----:----|----:----|----:----| X I S S N E Y S * S K L V C K A V S K S X S P L I R T R D R N * C V N Q * L N P H H F F E R V I V I K V C M K S C I Q I FatI |CviAII || MboI CviRI* || BclI | FatI || |NlaIII | |CviAII || ||DpnI | || NlaIII || |||BstKTI \ \\ \ \\ \\\\ TATTTGCAACATGACCAACAACAACAACAACAGCAACAACATGATCAACAACATAATCAA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| ATAAACGTTGTACTGGTTGTTGTTGTTGTTGTCGTTGTTGTACTAGTTGTTGTATTAGTT / / // / /// / | | |FatI | ||| BclI | | CviAII | ||| MboI | NlaIII | ||DpnI CviRI* | |BstKTI | |FatI | CviAII NlaIII Y L Q H D Q Q Q Q Q Q Q Q H D Q Q H N Q I C N M T N N N N N S N N M I N N I I N F A T * P T T T T T A T T * S T T * S T ----:----|----:----|----:----|----:----|----:----|----:----| * K C C S W C C C C C C C C S * C C L * N N A V H G V V V V V A V V H D V V Y D I Q L M V L L L L L L L L M I L L M I L BssKI EcoRII | ScrFI | BseBI SduI TspEI | |SetI HgiAI* \ \ \\ \ CAGCAACAACCACAACCACAACCAATTCAAACTCAAAACCTGGAGCACGACCACGACCAA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GTCGTTGTTGGTGTTGGTGTTGGTTAAGTTTGAGTTTTGGACCTCGTGCTGGTGCTGGTT / / / / / TspEI | | EcoRII Eco57MI | | HgiAI* GsuI | | BssKI | | SduI | BseBI | ScrFI SetI Q Q Q P Q P Q P I Q T Q N L E H D H D Q S N N H N H N Q F K L K T W S T T T T N A T T T T T T N S N S K P G A R P R P T ----:----|----:----|----:----|----:----|----:----|----:----| C C C G C G C G I * V * F R S C S W S W V A V V V V V V L E F E F G P A R G R G L L L W L W L W N L S L V Q L V V V V L CviRI* | BsmI | EcoT22I MnlI | | Hpy188I AsuI* | | | SfaNI |CviJI | | | | AsuI* |HaeIII | | | | AvaII |BmgT120I GsuI | | | | Hpy166II || MnlI Eco57MI | | | | |BmgT120I || |MlyI | MslI TspDTI TaqI | | | | || SetI || |PleI \ \ \ \ \ \ \ \ \\ \ \\ \\ CATACTAATGATATGAGTGCTTCATCGAATGCATCAGATAGTGGACCTCAAAGGCCCAAG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GTATGATTACTATACTCACGAAGTAGCTTACGTAGTCTATCACCTGGAGTTTCCGGGTTC / / / / / / //// / ///// | TspDTI | | | Hpy188I |||AvaII | ||||PleI MslI | | CviRI* |||AsuI* | |||MlyI | | BsmI ||| | ||AsuI* | EcoT22I ||| | |BmgT120I TaqI ||| | |MnlI ||| | HaeIII ||| | CviJI ||| MnlI ||BmgT120I |SfaNI |SetI Hpy166II H T N D M S A S S N A S D S G P Q R P K I L M I * V L H R M H Q I V D L K G P R Y * * Y E C F I E C I R * W T S K A Q E ----:----|----:----|----:----|----:----|----:----|----:----| C V L S I L A E D F A D S L P G * L G L V Y * H Y S H K M S H M L Y H V E F A W M S I I H T S * R I C * I T S R L P G L HinfI | Hin6I | FnuDII* | |GlaI MaeI ApoI | ||HhaI | HphI TspEI \ \\\ \ \ \ AGGACTCGCGCAAAGGGTGAAGCACTAGATGTGCTAAAGCGTAAATTTGAAATAAATCCA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TCCTGAGCGCGTTTCCCACTTCGTGATCTACACGATTTCGCATTTAAACTTTATTTAGGT / /// / / | ||Hin6I HphI TspEI | |GlaI MaeI ApoI | FnuDII* | HhaI HinfI R T R A K G E A L D V L K R K F E I N P G L A Q R V K H * M C * S V N L K * I Q D S R K G * S T R C A K A * I * N K S N ----:----|----:----|----:----|----:----|----:----|----:----| L V R A F P S A S S T S F R L N S I F G S S E R L P H L V L H A L A Y I Q F L D P S A C L T F C * I H * L T F K F Y I W MboI BglII XhoII Hpy188I | DpnI | |BstKTI MnlI MmeI | || Hpy188I BsmI MaeII \ \ \ \\ \ \ \ ACACCCTCTTTGGTAGAAAGAAAGAAAATATCAGATCTGATAGGAATGCCTGAAAAAAAC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TGTGGGAGAAACCATCTTTCTTTCTTTTATAGTCTAGACTATCCTTACGGACTTTTTTTG / / / // / / / MnlI MmeI | || Hpy188I BsmI TaiI | || XhoII SetI | || BglII | || MboI | |DpnI | BstKTI Hpy188I T P S L V E R K K I S D L I G M P E K N H P L W * K E R K Y Q I * * E C L K K T T L F G R K K E N I R S D R N A * K K R ----:----|----:----|----:----|----:----|----:----|----:----| V G E K T S L F F I D S R I P I G S F F L V R K P L F F S F I L D S L F A Q F F C G R Q Y F S L F Y * I Q Y S H R F F V TseI AluI |BisI SetI CviJI ||BlsI TaiI |MnlI |||FatI | Hpy188I Hpy188I ||SetI ||||CviAII | |ApoI |SapI |||TspEI ||||| NlaIII | |TspEI |Ksp632I* |||| MboII ||||| | BbvI \ \\ \\ \\\\ \ \\\\\ \ \ GTCAGAATTTGGTTTCAGAACAGAAGAGCTAAATTGAGGAAAAAGCAGCATGGAAGTAAT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTCTTAAACCAAAGTCTTGTCTTCTCGATTTAACTCCTTTTTCGTCGTACCTTCATTA / / / / / / / // /// // | | TspEI | | | CviJI |TspEI ||| |FatI | | ApoI | | | AluI MboII ||| CviAII | Hpy188I | | | MnlI ||NlaIII MaeII | | SetI ||TseI | Ksp632I* |BisI | SapI BlsI Hpy188I V R I W F Q N R R A K L R K K Q H G S N S E F G F R T E E L N * G K S S M E V I Q N L V S E Q K S * I E E K A A W K * * ----:----|----:----|----:----|----:----|----:----|----:----| T L I Q N * F L L A L N L F F C C P L L R * F K T E S C F L * I S S F A A H F Y D S N P K L V S S S F Q P F L L M S T I BsaBI |MboI || DpnI || |PvuI TatI MaeIII || |McrI* |Csp6I Tsp45I MnlI || |BstKTI ||RsaI \ \ \\ \\ \\\ AAGGACACAATCCCCTCGTCACAATCCCGTGATATTGCCAACGATTACGATCGTGGGAGT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCTGTGTTAGGGGAGCAGTGTTAGGGCACTATAACGGTTGCTAATGCTAGCACCCTCA / // / // / / BbvI |MnlI | || MboI RsaI Tsp45I | |DpnI MaeIII | BstKTI | McrI* | PvuI BsaBI K D T I P S S Q S R D I A N D Y D R G S R T Q S P R H N P V I L P T I T I V G V G H N P L V T I P * Y C Q R L R S W E Y ----:----|----:----|----:----|----:----|----:----|----:----| L S V I G E D C D R S I A L S * S R P L Y P C L G R T V I G H Y Q W R N R D H S L V C D G R * L G T I N G V I V I T P T MaeIII Tsp45I | FokI | | TspDTI | | | TatI | | | |Csp6I | | | ||RsaI | | | ||ScaI SetI TspEI | | | ||| BseGI Hpy178III* BbvII* \ \ \ \ \\\ \ \ \ ACAGACAACAATTTGGTCACTACAACAAGTACTTCATCCATATTTCACGATGAAGACCTG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TGTCTGTTGTTAAACCAGTGATGTTGTTCATGAAGTAGGTATAAAGTGCTACTTCTGGAC // / // / /// / / |TatI TspEI || FokI ||BseGI | SetI Csp6I |TspDTI ||TatI Hpy178III* Tsp45I |Csp6I MaeIII ScaI RsaI T D N N L V T T T S T S S I F H D E D L Q T T I W S L Q Q V L H P Y F T M K T * R Q Q F G H Y N K Y F I H I S R * R P D ----:----|----:----|----:----|----:----|----:----|----:----| V S L L K T V V V L V E D M N * S S S R Y L C C N P * * L L Y K M W I E R H L G C V V I Q D S C C T S * G Y K V I F V Q MboII |TspDTI || TaqI || | McrI* || | |Tsp4CI* || | || AciI || | || | NspBII* Hin4I CspCI MmeI \\ \ \\ \ \ \ \ \ ACTTTTTTCGACCGTATTCCGCTGAACAGCAACAACAACTATTATTTTTTTGACATTTGC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TGAAAAAAGCTGGCATAAGGCGACTTGTCGTTGTTGTTGATAATAAAAAAACTGTAAACG / / / / / / / TspDTI | Tsp4CI* NspBII* Hin4I CspCI MmeI BbvII* McrI* AciI MboII TaqI T F F D R I P L N S N N N Y Y F F D I C L F S T V F R * T A T T T I I F L T F A F F R P Y S A E Q Q Q Q L L F F * H L L ----:----|----:----|----:----|----:----|----:----|----:----| V K K S R I G S F L L L L * * K K S M Q S K K R G Y E A S C C C C S N N K Q C K S K E V T N R Q V A V V V I I K K V N A AciI |BisI ||BlsI |||TauI |||Hin6I ||||GlaI |||||BtsI |||||HhaI |||||| TspDTI |||||| |Hin4II* Tsp4CI* |||||| ||CviRI* TspEI | Hin4I CspCI |||||| ||| TspRI \ \ \ \ \\\\\\ \\\ \ TCAATTACTGTGGGAAGTTGGAATAGAATGAAAAGCGGCGCACTGCAAAGAAGGAACTTT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTAATGACACCCTTCAACCTTATCTTACTTTTCGCCGCGTGACGTTTCTTCCTTGAAA / / / / /////// / / | | Hin4I CspCI ||||||| | CviRI* | Tsp4CI* ||||||| Hin4II* TspEI ||||||TspDTI |||||Hin6I ||||GlaI |||TspRI |||HhaI |||BtsI ||BisI ||AciI |BlsI TauI S I T V G S W N R M K S G A L Q R R N F Q L L W E V G I E * K A A H C K E G T F N Y C G K L E * N E K R R T A K K E L S ----:----|----:----|----:----|----:----|----:----|----:----| E I V T P L Q F L I F L P A S C L L F K S L * Q P F N S Y F S F R R V A F F S S * N S H S T P I S H F A A C Q L S P V K MseI SetI VspI TaqI \ \ \ CAGTCTATAAAGGAGTTGAGAAACCTATCGCCAATAAAGATTAATAACATAATGTCGAAT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GTCAGATATTTCCTCAACTCTTTGGATAGCGGTTATTTCTAATTATTGTATTACAGCTTA / / / SetI VspI TaqI MseI Q S I K E L R N L S P I K I N N I M S N S L * R S * E T Y R Q * R L I T * C R M V Y K G V E K P I A N K D * * H N V E C ----:----|----:----|----:----|----:----|----:----|----:----| * D I F S N L F R D G I F I L L M I D F E T * L P T S F G I A L L S * Y C L T S L R Y L L Q S V * R W Y L N I V Y H R I XcmI DdeI BspCNI BsmI |MseI EcoRV | Hpy188I |BseMII \ \\ \ \ \ \\ GCCACAGATTTAATGGTTTTGATATCCAAGAAAAACTCAGAAATAAACTATTTTTTTAGT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTGTCTAAATTACCAAAACTATAGGTTCTTTTTGAGTCTTTATTTGATAAAAAAATCA / / / / // // BsmI | MseI EcoRV |DdeI |BseMII XcmI Hpy188I BspCNI A T D L M V L I S K K N S E I N Y F F S P Q I * W F * Y P R K T Q K * T I F L V H R F N G F D I Q E K L R N K L F F * C ----:----|----:----|----:----|----:----|----:----|----:----| A V S K I T K I D L F F E S I F * K K L H W L N L P K S I W S F S L F L S N K * G C I * H N Q Y G L F V * F Y V I K K T FatI NcoI StyI SecI* DsaI* |CviAII Hpy178III* || NlaIII |Ksp632I* || | Eco57I ||MboI || | Eco57MI ||XhoII MaeIII || | | MboII ||| DpnI Tsp45I || | | | ApoI ||| |BstKTI | Hpy178III* || | | | TspEI ||| || BinI* MseI | | TspEI \\ \ \ \ \ \\\ \\ \ \ \ \ \ GCCATGGCAAATAATACTAAAATTCTCTTCAGGATCTTTTTCCCATTAAGTTCAGTCACG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTACCGTTTATTATGATTTTAAGAGAAGTCCTAGAAAAAGGGTAATTCAAGTCAGTGC / // / / / /// / / / / | || | MboII TspEI ||| | BinI* MseI Hpy178III* | || Eco57MI ApoI ||| XhoII Tsp45I | || Eco57I ||| MboI MaeIII | |DsaI* ||Ksp632I* | |SecI* ||DpnI | |StyI |BstKTI | |NcoI Hpy178III* | |FatI | CviAII NlaIII A M A N N T K I L F R I F F P L S S V T P W Q I I L K F S S G S F S H * V Q S R H G K * Y * N S L Q D L F P I K F S H E ----:----|----:----|----:----|----:----|----:----|----:----| A M A F L V L I R K L I K K G N L E T V H W P L Y Y * F E R * S R K G M L N L * G H C I I S F N E E P D K E W * T * D R Hpy99I MaeIII \ \ AATTGCTCTCTAACTTTAGAAACTGACGACGATATAATAAATAGTAACAACACAAGCGAT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TTAACGAGAGATTGAAATCTTTGACTGCTGCTATATTATTTATCATTGTTGTGTTCGCTA / / / TspEI Hpy99I MaeIII N C S L T L E T D D D I I N S N N T S D I A L * L * K L T T I * * I V T T Q A I L L S N F R N * R R Y N K * * Q H K R * ----:----|----:----|----:----|----:----|----:----|----:----| F Q E R V K S V S S S I I F L L L V L S S N S E L K L F Q R R Y L L Y Y C C L R I A R * S * F S V V I Y Y I T V V C A I Hpy99I | Tsp4CI* BbvII* \ \ \ AAAAACAATAGTAATACTAATAATGATGATGATAACGACGATAACAGTAATGAAGACAAT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTGTTATCATTATGATTATTACTACTACTATTGCTGCTATTGTCATTACTTCTGTTA / / Hpy99I Tsp4CI* K N N S N T N N D D D N D D N S N E D N K T I V I L I M M M I T T I T V M K T M K Q * * Y * * * * * * R R * Q * * R Q * ----:----|----:----|----:----|----:----|----:----|----:----| L F L L L V L L S S S L S S L L L S S L Y F C Y Y Y * Y H H H Y R R Y C Y H L C F V I T I S I I I I I V V I V T I F V I HphI AluI FalI FalI CviJI | SetI MboII DdeI | | MaeIII |TspDTI FalI Bpu10I | | Tsp45I ||MnlI MnlI FalI |BsmI TspEI | | Tsp4CI* \\\ \ \ \\ \ \ \ \ GATAATAGTAGTGAGGATAAGAGGAATGCTAAGGATAACTTTGGAGAATTGAAGCTAACA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CTATTATCATCACTCCTATTCTCCTTACGATTCCTATTGAAACCTCTTAACTTCGATTGT / / / / / / // /// / | MnlI | FalI | Bpu10I || ||| Tsp4CI* TspDTI | FalI | DdeI || ||CviJI BbvII* MnlI BsmI || ||AluI MboII || |HphI || SetI |TspEI FalI FalI D N S S E D K R N A K D N F G E L K L T I I V V R I R G M L R I T L E N * S * Q * * * * G * E E C * G * L W R I E A N S ----:----|----:----|----:----|----:----|----:----|----:----| S L L L S S L L F A L S L K P S N F S V H Y Y Y H P Y S S H * P Y S Q L I S A L I I T T L I L P I S L I V K S F Q L * C Hpy178III* | BinI* | | BsaBI | | |MboI | | |XhoII TaqII | | || DpnI MboI Hpy166II | | || |BstKTI | DpnI | MseI | | || || ApoI HphI | |BstKTI | |AhaIII* | | || || TspEI \ \ \\ \ \\ \ \ \\ \\ \ GTCACCAGATCACCCACTTTTGCTGTTTACTTTTTAAATAATGCTCCTGATGAAGATCCA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTGGTCTAGTGGGTGAAAACGACAAATGAAAAATTTATTACGAGGACTACTTCTAGGT / / // / / / // / / / // / | | || MboI | | |MseI | | | || XhoII | | |DpnI | | AhaIII* | | | || MboI | | BstKTI | Hpy166II | | | |DpnI | Tsp45I TaqII | | | BstKTI | MaeIII | | BsaBI HphI | BinI* Hpy178III* V T R S P T F A V Y F L N N A P D E D P S P D H P L L L F T F * I M L L M K I Q H Q I T H F C C L L F K * C S * * R S K ----:----|----:----|----:----|----:----|----:----|----:----| T V L D G V K A T * K K F L A G S S S G L * W I V W K Q Q K S K L Y H E Q H L D D G S * G S K S N V K * I I S R I F I W Hin4II* | DdeI | | Hpy188I | | | AccI AsuI* | | | SetI AvaII | | | |Hpy166II |BmgT120I | | | || BspCNI ||Hin4I | | | || |BseMII MboII ||TspRI | | | || ||Hin4I |TspDTI ||| NdeI | | | || ||| SetI \\ \\\ \ \ \ \ \\ \\\ \ AATTTGAACAATCAGTGGTCCATATGTGATGATTTCTCAGAAGGTAGACAGGTAAATGAC 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAACTTGTTAGTCACCAGGTATACACTACTAAAGAGTCTTCCATCTGTCCATTTACTG // / / // / / // / //// |TspEI | | || NdeI | || SetI |||SetI |ApoI | | |AvaII | |DdeI ||BseMII TspDTI | | |AsuI* | Hpy188I |BspCNI MboII | | BmgT120I Hin4II* |AccI | Hin4I Hpy166II TspRI Hin4I N L N N Q W S I C D D F S E G R Q V N D I * T I S G P Y V M I S Q K V D R * M T F E Q S V V H M * * F L R R * T G K * R ----:----|----:----|----:----|----:----|----:----|----:----| F K F L * H D M H S S K E S P L C T F S L N S C D T T W I H H N R L L Y V P L H I Q V I L P G Y T I I E * F T S L Y I V SetI |Hpy166II || TspDTI TaqI || | MseI AsuII || | | TfiI HgaI | SspI MnlI || | | HinfI \ \ \ \ \\ \ \ \ GCATTTGTTGGTGGTTCGAATATTCCTCACACTTTGAAAGGTTTACAGAAATCATTAAGA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CGTAAACAACCACCAAGCTTATAAGGAGTGTGAAACTTTCCAAATGTCTTTAGTAATTCT / / / / / / / / HgaI | SspI | SetI | TspDTI MseI AsuII MnlI Hpy166II TaqI A F V G G S N I P H T L K G L Q K S L R H L L V V R I F L T L * K V Y R N H * D I C W W F E Y S S H F E R F T E I I K I ----:----|----:----|----:----|----:----|----:----|----:----| A N T P P E F I G * V K F P K C F D N L R M Q Q H N S Y E E C K S L N V S I M L C K N T T R I N R V S Q F T * L F * * S FatI BspHI SspI |CviAII |Hin4I |Hpy178III* |Hin4I || Hin4I ||EcoP15I || Hin4I ||| SetI || |TspEI ||| | MboI || ApoI || XbaI ||| | TspDTI || TspEI || |MaeI ||| | | DpnI || EcoRI || |TspDTI ||| | | |BstKTI || NlaIII || |Hpy178III* TaqI ||| | | || BinI* \\ \ \\ \\ \ \\\ \ \ \\ \ TTCATGAATTCTCTAATTCTAGACTATAAATCATCGAATGAAATATTACCTACGATCAAT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTACTTAAGAGATTAAGATCTGATATTTAGTAGCTTACTTTATAATGGATGCTAGTTA / // / / // // / / / // / // / | || | EcoRI || |XbaI | | | || | || MboI | || | TspEI || Hpy178III* | | | || | |DpnI | || | ApoI || MaeI | | | || | BstKTI | || Hin4I |TspEI | | | || TspDTI | || Hin4I TspDTI | | | |EcoP15I | |BspHI | | | SetI | |FatI | | SspI | Hpy178III* | Hin4I | CviAII | Hin4I NlaIII TaqI HinfI TfiI F M N S L I L D Y K S S N E I L P T I N S * I L * F * T I N H R M K Y Y L R S I H E F S N S R L * I I E * N I T Y D Q Y ----:----|----:----|----:----|----:----|----:----|----:----| N M F E R I R S * L D D F S I N G V I L I * S N E L E L S Y I M S H F I V * S * E H I R * N * V I F * R I F Y * R R D I TseI |BisI BbvI |SfeI* | MboI ||BlsI MnlI | | DpnI ||TspRI Hpy188I | | |BstKTI |||CviRI* | ApoI | | || BtsI |||| PstI SspI | TspEI \ \ \\ \ \\\\ \ \ \ \ ACAGCGATCCCCACTGCTGCAGTTCCACAACAGAATATTGCCCCTCCCTTTCTGAATACA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TGTCGCTAGGGGTGACGACGTCAAGGTGTTGTCTTATAACGGGGAGGGAAAGACTTATGT / // / /// / / / | || TspRI ||| SfeI* SspI Hpy188I | || MboI ||CviRI* MnlI | || BtsI ||TseI | |DpnI |BisI | |BbvI BlsI | BstKTI PstI BinI* T A I P T A A V P Q Q N I A P P F L N T Q R S P L L Q F H N R I L P L P F * I Q S D P H C C S S T T E Y C P S L S E Y K ----:----|----:----|----:----|----:----|----:----|----:----| V A I G V A A T G C C F I A G G K R F V Y L S G W Q Q L E V V S Y Q G E R E S Y C R D G S S C N W L L I N G R G K Q I C MboII | Hin4I | Hin4I | Ksp632I* | |TaqI | ||MboI MlyI MboII | ||| DpnI PleI |TfiI | ||| |FatI CviRI* ApoI |HinfI | ||| |BspHI | HinfI TspEI || MboII | ||| |BstKTI \ \ \ \\ \ \ \\\ \\ AATTCAAGTGCAACAGACTCAAATCCAAATACAAATTTAGAAGATTCTCTCTTCTTCGAT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAGTTCACGTTGTCTGAGTTTAGGTTTATGTTTAAATCTTCTAAGAGAGAAGAAGCTA / // / / / / / // /// TspEI |PleI HinfI | | | | |MboII ||NlaIII ApoI CviRI* | | | | Hin4I |DpnI MlyI | | | | Hin4I Ksp632I* | | | HinfI BstKTI | | | TfiI TaqI | | MboII | MboII TspEI ApoI N S S A T D S N P N T N L E D S L F F D I Q V Q Q T Q I Q I Q I * K I L S S S I F K C N R L K S K Y K F R R F S L L R S ----:----|----:----|----:----|----:----|----:----|----:----| F E L A V S E F G F V F K S S E R K K S L N L H L L S L D L Y L N L L N E R R R I * T C C V * I W I C I * F I R E E E I CviAII Hpy178III* |BsaBI ||MboI |||NlaIII ||||DpnI Hin4I AcyI |||||BstKTI TaqI TaqI Hin4I TsoI CviJI TspGWI MaeII \\\\\\ \ \ \ \ \ \ \ CATGATCTGTTATCGAGTTCGATAACCAACACCAACAACGGACAAGGCTCTAATAATGGA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| GTACTAGACAATAGCTCAAGCTATTGGTTGTGGTTGTTGCCTGTTCCGAGATTATTACCT ///// / / // / / / / ||||| MboI TaqI |Hin4I TsoI | TspGWI AatII ||||DpnI |Hin4I CviJI TaiI |||BstKTI TaqI SetI |||BspHI |||FatI ||Hpy178III* ||CviAII |BsaBI MboI H D L L S S S I T N T N N G Q G S N N G M I C Y R V R * P T P T T D K A L I M D * S V I E F D N Q H Q Q R T R L * * W T ----:----|----:----|----:----|----:----|----:----|----:----| * S R N D L E I V L V L L P C P E L L P D H D T I S N S L W C W C R V L S * Y H M I Q * R T R Y G V G V V S L A R I I S ZraI | SetI | TaiI | AatII | | NheI | | AluI | | CviJI | | |MaeI TspEI | | ||SetI |FokI Tsp4CI* | | ||Cac8I ||BaeI | HindII | | ||| BmtI BseGI |||BciVI BsrI | Hpy166II \ \ \\\ \ \ \\\\ \ \ \ CGTCAAGCTAGCAAGGATGATACGCTCAATTTACTGGATACTACCGTCAACAGCAATAAC 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| GCAGTTCGATCGTTCCTACTATGCGAGTTAAATGACCTATGATGGCAGTTGTCGTTATTG // / / /// / / / // / / / / || | | ||NheI | BaeI | || BsrI | Hpy166II BaeI || | | |MaeI BseGI | |FokI | HindII || | | Cac8I | TspEI Tsp4CI* || | CviJI BciVI || | AluI || | BmtI || SetI |MaeII |AcyI ZraI R Q A S K D D T L N L L D T T V N S N N V K L A R M I R S I Y W I L P S T A I T S S * Q G * Y A Q F T G Y Y R Q Q Q * Q ----:----|----:----|----:----|----:----|----:----|----:----| R * A L L S S V S L K S S V V T L L L L V D L * C P H Y A * N V P Y * R * C C Y T L S A L I I R E I * Q I S G D V A I V MaeI | Hin6I | BseRI BdaI BdaI TfiI | |GlaI BdaI BaeI BdaI MnlI HinfI | ||HhaI | SfaNI \ \ \ \ \ \\\ \ \ AATCATAATGCTAATAATGAGGAGAATCATCTAGCGCAAGAACATTTATCCAACGATGCT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TTAGTATTACGATTATTACTCCTCTTAGTAGATCGCGTTCTTGTAAATAGGTTGCTACGA / / / ///// / / BdaI MnlI | ||||| BdaI SfaNI BdaI | ||||| BdaI | ||||Hin6I | |||GlaI | ||HhaI | |MaeI | BseRI HinfI TfiI N H N A N N E E N H L A Q E H L S N D A I I M L I M R R I I * R K N I Y P T M L S * C * * * G E S S S A R T F I Q R C * ----:----|----:----|----:----|----:----|----:----|----:----| L * L A L L S S F * R A C S C K D L S A C D Y H * Y H P S D D L A L V N I W R H I M I S I I L L I M * R L F M * G V I S MboI BclI GsuI CviRI* | DpnI Eco57MI | MmeI | |BstKTI | Hpy166II \ \ \ \\ \ \ GATATTGTTGCAAATCCAAATGATCATTTGTTGTCTTTACCGACTGATAGTGAACTCCCA 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| CTATAACAACGTTTAGGTTTACTAGTAAACAACAGAAATGGCTGACTATCACTTGAGGGT / / // / / / | MmeI || BclI | Hpy166II CviRI* || MboI Eco57MI |DpnI GsuI BstKTI D I V A N P N D H L L S L P T D S E L P I L L Q I Q M I I C C L Y R L I V N S Q Y C C K S K * S F V V F T D * * * T P K ----:----|----:----|----:----|----:----|----:----|----:----| S I T A F G F S * K N D K G V S L S S G Q Y Q Q L D L H D N T T K V S Q Y H V G I N N C I W I I M Q Q R * R S I T F E W Hpy178III* MboII BccI \ \ \ AATACTCCAGATTTTTTGAAGAACACTAACGAACTAACTGACGAGCATAGATGGATATGA 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| TTATGAGGTCTAAAAAACTTCTTGTGATTGCTTGATTGACTGCTCGTATCTACCTATACT / / / Hpy178III* MboII BccI N T P D F L K N T N E L T D E H R W I * I L Q I F * R T L T N * L T S I D G Y X Y S R F F E E H * R T N * R A * M D M X ----:----|----:----|----:----|----:----|----:----|----:----| F V G S K K F F V L S S V S S C L H I H L Y E L N K S S C * R V L Q R A Y I S I I S W I K Q L V S V F * S V L M S P Y S # Enzymes that cut Frequency Isoschizomers AatII 1 AccI 1 FblI,XmiI AciI 2 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AhaIII* 1 DraI AluI 3 AluBI ApoI 8 AcsI,XapI AsuI* 3 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BbvI 2 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 1 BciVI 1 BfuI BclI 2 FbaI,Ksp22I BdaI 2 BglII 1 BinI* 3 AlwI,BspPI,AclWI BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BmgT120I 3 BmtI 1 BspOI Bpu10I 1 BsaBI 3 Bse8I,BseJI BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 2 BstF5I,BtsCI BseMII 2 BseRI 1 BsmI 4 BsaMI,Mva1269I,PctI BspCNI 2 BspHI 2 CciI,PagI,RcaI BsrI 1 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstKTI 12 BtsI 2 Cac8I 1 BstC8I Csp6I 3 CviQI,RsaNI CspCI 1 CviAII 6 CviJI 5 CviKI-1 CviRI* 6 HpyCH4V DdeI 3 BstDEI,HpyF3I DpnI 12 MalI DsaI* 1 BtgI,BstDSI Eco57I 1 AcuI Eco57MI 3 EcoP15I 1 EcoRI 2 EcoRII 1 AjnI,Psp6I,PspGI EcoRV 1 Eco32I EcoT22I 1 Mph1103I,NsiI,Zsp2I FalI 2 FatI 6 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 2 GlaI 3 GsuI 2 BpmI HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HhaI 3 BstHHI,CfoI,AspLEI Hin4I 6 Hin4II* 2 HpyAV Hin6I 3 HinP1I,HspAI HindII 1 HincII HinfI 5 HphI 3 AsuHPI Hpy166II 6 Hpy8I Hpy178III* 9 Hpy188III Hpy188I 8 Hpy99I 2 Ksp632I* 3 Eam1104I,EarI,Bst6I MaeI 4 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 5 MboI 12 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 10 McrI* 2 BsiEI,BstMCI,Bsh1285I MlyI 2 SchI MmeI 3 MnlI 10 MseI 6 Tru1I,Tru9I MslI 1 RseI,SmiMI NcoI 1 Bsp19I NdeI 1 FauNDI NheI 1 AsuNHI NlaIII 6 Hin1II,Hsp92II,FaeI NspBII* 1 MspA1I PleI 2 PpsI PstI 1 PvuI 1 MvrI,Ple19I,BpvUI RsaI 3 AfaI SapI 1 LguI,PciSI,BspQI ScaI 1 BmcAI,AssI,ZrmI ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 1 BseDI,BssECI,BsaJI SetI 13 SfaNI 2 LweI SfeI* 2 BstSFI,SfcI,BfmI SplI* 1 Pfl23II,PspLI,BsiWI SspI 3 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 2 TaqI 8 TaqII 1 TatI 2 TauI 1 TfiI 3 PfeI TseI 2 ApeKI TsoI 1 Tsp45I 4 NmuCI Tsp4CI* 5 HpyCH4III,TaaI,Bst4CI TspDTI 9 TspEI 16 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 3 TscAI VspI 1 PshBI,AseI XbaI 1 XcmI 1 XhoII 3 BstYI,MflI,PsuI,BstX2I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AbsI Acc65I AclI AflII AflIII AgeI AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AvaI AvrII BalI BamHI BarI BbvCI Bce83I* BceAI BcgI BetI* BfiI BglI BmeT110I BplI BsaAI BsaXI BsePI BseSI BseYI BsgI BsiI* BsiYI* BslFI BsmAI BsmFI Bsp120I Bsp1407I BspLU11I* BspMI BspMII* BsrBI BsrDI BssNAI Bst1107I BstAPI BstEII BstXI BstZ17I BtgZI BtrI CauII* Cfr10I Cfr9I CfrI ClaI DinI DraII DraIII DrdI Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EgeI EheI Esp3I EspI* FaqI FauI FseI FspAI GsaI HaeII HgiCI* HgiJII* HindIII HpaI HpaII KasI KpnI MauBI MfeI MluI MroNI MstI* MwoI NaeI NarI NgoMIV NlaIV NmeAIII NotI NruI NspI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PvuII RsrII SacI SacII SalI SanDI SauI* SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SrfI Sse232I* Sse8387I StuI SwaI TspMI TstI Tth111I XhoI XmaCI XmaI XmaIII* XmnI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769