Restriction Map of MSH3/YCR092C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

MSH3/YCR092C on chromosome III from coordinates 279820 to 276764.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.21072

EMBOSS_001 SetI Hpy188I | Hin4II* | AluI | | Hpy178III* | CviJI AciI BspMI BslFI | | | AciI | | SetI \ \ \ \ \ \ \ \ \ \ ATGGCGGGACAACCCACAATAAGCAGGTTTTTCAAGAAGGCGGTAAAATCAGAGCTGACG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCGCCCTGTTGGGTGTTATTCGTCCAAAAAGTTCTTCCGCCATTTTAGTCTCGACTGC / / / / / / / / / AciI BspMI | | | AciI | | CviJI | | Hpy178III* | | AluI | Hin4II* | SetI BslFI Hpy188I SetI M A G Q P T I S R F F K K A V K S E L T W R D N P Q * A G F S R R R * N Q S * R G G T T H N K Q V F Q E G G K I R A D A ----:----|----:----|----:----|----:----|----:----|----:----| X A P C G V I L L N K L F A T F D S S V X P P V V W L L C T K * S P P L I L A S H R S L G C Y A P K E L L R Y F * L Q R Hin6I |GlaI ||HhaI MmeI |||HaeII HgaI |||| AjuI TfiI | AjuI AciI |||| |MwoI HinfI BccI \ \ \ \\\\ \\ \ \ CATAAGCAAGAACAAGAAGTTGCGGTTGGAAATGGCGCTGGTAGCGAATCCATCTGCCTT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GTATTCGTTCTTGTTCTTCAACGCCAACCTTTACCGCGACCATCGCTTAGGTAGACGGAA // / / ///// / // |MmeI HgaI AciI ||||MwoI HinfI |TspRI AjuI |||Hin6I TfiI BccI ||GlaI |AjuI |HhaI HaeII H K Q E Q E V A V G N G A G S E S I C L I S K N K K L R L E M A L V A N P S A L * A R T R S C G W K W R W * R I H L P * ----:----|----:----|----:----|----:----|----:----|----:----| C L C S C S T A T P F P A P L S D M Q R A Y A L V L L Q P Q F H R Q Y R I W R G M L L F L F N R N S I A S T A F G D A K Ksp632I* |MnlI MboII CviRI* ||Hin4I |TspEI | Cac8I ||Hin4I || MboII | | Hin4I MaeIII AluI ||| TspRI || |TspDTI | | Hin4I Tsp4CI* CviJI \\\ \ \\ \\ \ \ \ \ \ GACACTGATGAAGAGGACAATTTATCTTCTGTTGCAAGCACAACAGTAACTAATGATAGC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTGACTACTTCTCCTGTTAAATAGAAGACAACGTTCGTGTTGTCATTGATTACTATCG / / / / // / / / / / / | | | | |TspEI | Cac8I | MaeIII | CviJI | | | | TspDTI CviRI* Tsp4CI* | AluI | | | | MboII Hin4I SetI | | | MboII Hin4I | | Ksp632I* | MnlI Hin4I Hin4I D T D E E D N L S S V A S T T V T N D S T L M K R T I Y L L L Q A Q Q * L M I A H * * R G Q F I F C C K H N S N * * * L ----:----|----:----|----:----|----:----|----:----|----:----| S V S S S S L K D E T A L V V T V L S L Q C Q H L P C N I K Q Q L C L L L * H Y V S I F L V I * R R N C A C C Y S I I A ApoI TspEI EcoRI | TaqI | AsuII Hpy188I BsiYI* BtsI | | ApoI | SpeI Csp6I SetI | MboII TspRI | | TspEI | |MaeI |RsaI \ \ \ \ \ \ \ \ \\ \\ TTTCCACTCAAAGGCAGTGTTTCTTCCAAGAATTCGAAAAATTCAGAAAAGACTAGTGGT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AAAGGTGAGTTTCCGTCACAAAGAAGGTTCTTAAGCTTTTTAAGTCTTTTCTGATCACCA / // / / / // // / | |MboII BtsI | AsuII |Hpy188I || RsaI | TspRI | TaqI TspEI |SpeI BsiYI* EcoRI ApoI MaeI TspEI ApoI F P L K G S V S S K N S K N S E K T S G F H S K A V F L P R I R K I Q K R L V V S T Q R Q C F F Q E F E K F R K D * W Y ----:----|----:----|----:----|----:----|----:----|----:----| K G S L P L T E E L F E F F E S F V L P S E V * L C H K K W S N S F N L F S * H K W E F A T N R G L I R F I * F L S T T TaqI MseI DdeI TspEI \ \ \ \ ACTTCGACAACATTTAATGATATTGACTTTGCTAAGAAATTGGATAGGATTATGAAAAGA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TGAAGCTGTTGTAAATTACTATAACTGAAACGATTCTTTAACCTATCCTAATACTTTTCT / / / / / | TaqI MseI DdeI TspEI Csp6I T S T T F N D I D F A K K L D R I M K R L R Q H L M I L T L L R N W I G L * K D F D N I * * Y * L C * E I G * D Y E K T ----:----|----:----|----:----|----:----|----:----|----:----| V E V V N L S I S K A L F N S L I I F L Y K S L M * H Y Q S Q * S I P Y S * S F S R C C K I I N V K S L F Q I P N H F S Ksp632I* CviJI |MnlI Eco57I TspDTI |TspDTI || MboII Eco57MI | MnlI || MnlI || | MnlI | MboII HphI \ \ \\ \ \\ \ \ \ \ \ CGAAGTGATGAAAATGTTGAGGCTGAAGATGATGAGGAAGAGGGTGAGGAAGATTTCGTA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GCTTCACTACTTTTACAACTCCGACTTCTACTACTCCTTCTCCCACTCCTTCTAAAGCAT / / // / / // / / / / / | MnlI || MnlI | || | | MboII HphI MboII TspDTI |CviJI | || | Eco57MI TspDTI | || | Eco57I | || MnlI | |MboII | Ksp632I* MnlI R S D E N V E A E D D E E E G E E D F V E V M K M L R L K M M R K R V R K I S * K * * K C * G * R * * G R G * G R F R K ----:----|----:----|----:----|----:----|----:----|----:----| R L S S F T S A S S S S S S P S S S K T V F H H F H Q P Q L H H P L P H P L N R S T I F I N L S F I I L F L T L F I E Y Hin4II* | SetI | | AsuI* | | AvaII MboII StyI | | DraII | BslFI CviJI SfeI* SecI* | | PpuMI \ \ \ \ \ \ \ \ AAAAAAAAAGCCAGAAAGTCCCCTACAGCGAAACTTACTCCCTTGGACAAACAGGTGAAG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTTTTTCGGTCTTTCAGGGGATGTCGCTTTGAATGAGGGAACCTGTTTGTCCACTTC / / / / / / | CviJI SfeI* | | SetI BslFI | Hin4II* SecI* StyI K K K A R K S P T A K L T P L D K Q V K K K K P E S P L Q R N L L P W T N R * R K K S Q K V P Y S E T Y S L G Q T G E G ----:----|----:----|----:----|----:----|----:----|----:----| F F F A L F D G V A F S V G K S L C T F L F F L W F T G * L S V * E R P C V P S F F F G S L G R C R F K S G Q V F L H L BmgT120I CviRI* TatI | SetI | EcoT22I |Csp6I | |HphI | | SfaNI CviJI ||RsaI \ \\ \ \ \ \ \\\ GACCTGAAAATGCATCATAGAGATAAAGTGCTTGTTATTAGAGTAGGCTACAAGTACAAA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CTGGACTTTTACGTAGTATCTCTATTTCACGAACAATAATCTCATCCGATGTTCATGTTT /// / / / / / /// ||| HphI | CviRI* SfaNI CviJI ||TatI ||PpuMI EcoT22I |Csp6I ||DraII RsaI ||AvaII ||AsuI* |BmgT120I SetI D L K M H H R D K V L V I R V G Y K Y K T * K C I I E I K C L L L E * A T S T N P E N A S * R * S A C Y * S R L Q V Q M ----:----|----:----|----:----|----:----|----:----|----:----| S R F I C * L S L T S T I L T P * L Y L P G S F A D Y L Y L A Q * * L L S C T C V Q F H M M S I F H K N N S Y A V L V F MnlI SfaNI | CviRI* | | MwoI | | BstAPI | | | CviRI* | | | | BseGI BssKI | | | | MaeIII EcoRII | | | | | Tsp4CI* | ScrFI | | | | | |FokI | BseBI \ \ \ \ \ \\ \ \ TGTTTTGCAGAGGATGCAGTAACGGTTAGCAGAATACTTCACATCAAACTTGTGCCTGGA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| ACAAAACGTCTCCTACGTCATTGCCAATCGTCTTATGAAGTGTAGTTTGAACACGGACCT / / / / / / / / MnlI | | CviRI* | FokI | EcoRII | | BseGI Tsp4CI* | BssKI | BstAPI MaeIII BseBI | MwoI ScrFI CviRI* SfaNI C F A E D A V T V S R I L H I K L V P G V L Q R M Q * R L A E Y F T S N L C L E F C R G C S N G * Q N T S H Q T C A W K ----:----|----:----|----:----|----:----|----:----|----:----| H K A S S A T V T L L I S * M L S T G P I N Q L P H L L P * C F V E C * V Q A Q T K C L I C Y R N A S Y K V D F K H R S PleI |MlyI ||SmlI TaqI ||| Hpy178III* ClaI ||| | MnlI Csp6I Bce83I* ||| | BsaBI |RsaI TspEI | HinfI ||| | CviRI* || Tsp4CI* \ \ \ \\\ \ \ \\ \ AAATTGACTATCGATGAGTCTAATCCTCAAGATTGCAATCATAGGCAGTTTGCGTACTGT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAACTGATAGCTACTCAGATTAGGAGTTCTAACGTTAGTATCCGTCAAACGCATGACA / / / / / / // /// | | ClaI HinfI PleI | |CviRI* ||Tsp4CI* | | TaqI MlyI | |BsaBI |Csp6I | Bce83I* | MnlI RsaI TspEI Hpy178III* SmlI K L T I D E S N P Q D C N H R Q F A Y C N * L S M S L I L K I A I I G S L R T V I D Y R * V * S S R L Q S * A V C V L F ----:----|----:----|----:----|----:----|----:----|----:----| F N V I S S D L G * S Q L * L C N A Y Q F I S * R H T * D E L N C D Y A T Q T S F Q S D I L R I R L I A I M P L K R V T BseGI |Hpy188I || HphI || MseI || | FokI || | |AclI || | |MaeII || | || SetI CviRI* PfoI || | || TaiI | BceAI BssKI || | || |Hpy166II | | TspEI | HpaII || | || || BsmAI | | | SfaNI | ScrFI || | || || |MaeI | | | |MseI | CauII* || | || || ||SetI | | | ||AhaIII* \ \ \\ \ \\ \\ \\\ \ \ \ \\\ TCTTTCCCGGATGTCAGATTAAACGTTCACCTAGAGAGACTTGTGCATCATAATTTAAAG 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAAGGGCCTACAGTCTAATTTGCAAGTGGATCTCTCTGAACACGTAGTATTAAATTTC /// / / / // //// // / / //// ||| | | | || |||SetI |BsmAI | | |||SfaNI ||| | | | || ||| MaeI | | |||SetI ||| | | | || ||Hpy166II | | ||MseI ||| | | | || |FokI | | |AhaIII* ||| | | | || MaeII | | TspEI ||| | | | || AclI | BceAI ||| | | | |TaiI CviRI* ||| | | | |SetI ||| | | | MseI ||| | | HphI ||| | Hpy188I ||| BseGI ||BssKI ||PfoI |HpaII CauII* ScrFI S F P D V R L N V H L E R L V H H N L K L S R M S D * T F T * R D L C I I I * R F P G C Q I K R S P R E T C A S * F K G ----:----|----:----|----:----|----:----|----:----|----:----| E K G S T L N F T * R S L S T C * L K F N K G P H * I L R E G L S V Q A D Y N L R E R I D S * V N V * L S K H M M I * L BinI* | FatI | |CviAII | || MboI | || |NlaIII | || ||DpnI | || |||BssKI | || |||EcoRII | || |||BstKTI Hin6I | || |||| ScrFI |GlaI | || |||| BseBI |Eco47III | || |||| | HgiCI* SetI ||HhaI | || |||| | | SetI | SecI* |||HaeII | || |||| | | NlaIV | DsaI* Cac8I |||| MseI | || |||| | | | Cac8I \ \ \ \\\\ \ \ \\ \\\\ \ \ \ \ GTTGCCGTGGTAGAGCAAGCAGAAACAAGCGCTATTAAGAAGCATGATCCAGGTGCCAGC 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CAACGGCACCATCTCGTTCGTCTTTGTTCGCGATAATTCTTCGTACTAGGTCCACGGTCG / / //// / // /// /// // // DsaI* Cac8I |||Hin6I | || ||| ||| || |Cac8I SecI* ||| | || ||| ||| || HgiCI* ||| | || ||| ||| |NlaIV ||| | || ||| ||| EcoRII ||| | || ||| ||| BssKI ||| | || ||| ||BseBI ||| | || ||| ||ScrFI ||| | || ||| |SetI ||| | || ||| MboI ||| | || ||DpnI ||| | || |BstKTI ||| | || |FatI ||| | || CviAII ||| | |NlaIII ||| | BinI* ||| MseI ||Eco47III ||GlaI |HhaI HaeII V A V V E Q A E T S A I K K H D P G A S L P W * S K Q K Q A L L R S M I Q V P A C R G R A S R N K R Y * E A * S R C Q Q ----:----|----:----|----:----|----:----|----:----|----:----| T A T T S C A S V L A I L F C S G P A L P Q R P L A L L F L R * * S A H D L H W N G H Y L L C F C A S N L L M I W T G A AluI CviJI MseI MwoI XmnI | SetI |TspEI \ \ \ \ \\ AAATCAAGCGTTTTTGAAAGAAAGATTTCAAATGTCTTTACCAAAGCTACATTTGGTGTT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAGTTCGCAAAAACTTTCTTTCTAAAGTTTACAGAAATGGTTTCGATGTAAACCACAA / / / / MwoI XmnI | CviJI | AluI SetI K S S V F E R K I S N V F T K A T F G V N Q A F L K E R F Q M S L P K L H L V L I K R F * K K D F K C L Y Q S Y I W C * ----:----|----:----|----:----|----:----|----:----|----:----| L D L T K S L F I E F T K V L A V N P T C I L R K Q F F S K L H R * W L * M Q H F * A N K F S L N * I D K G F S C K T N MaeII BslFI BdaI DdeI | SetI |HphI BdaI SetI SauI* | TaiI |Tsp4CI* CviJI \ \ \ \ \\ \ AATTCCACCTTTGTCCTTAGGGGGAAACGTATTCTCGGTGATACAAACAGTATATGGGCT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAGGTGGAAACAGGAATCCCCCTTTGCATAAGAGCCACTATGTTTGTCATATACCCGA / / / / / / / / / / | | SetI SauI* | MaeII | | | CviJI | TspEI DdeI TaiI | | BdaI MseI SetI | | BdaI | BslFI Tsp4CI* HphI N S T F V L R G K R I L G D T N S I W A I P P L S L G G N V F S V I Q T V Y G L F H L C P * G E T Y S R * Y K Q Y M G F ----:----|----:----|----:----|----:----|----:----|----:----| L E V K T R L P F R I R P S V F L I H A * N W R Q G * P S V Y E R H Y L C Y I P I G G K D K P P F T N E T I C V T Y P S MaeIII Tsp45I | MaeII | | Csp6I SetI TspEI | | |RsaI | CviJI | MseI | | |SetI | |BdaI MseI | |SwaI | | |TaiI TsoI | |BdaI SspI |TspEI | |AhaIII* \ \ \\ \ \ \\ \ \\ \ \\ TTGTCCCGTGACGTACATCAGGGAAAGGTGGCTAAATATTCCTTAATTTCTGTCAATTTA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| AACAGGGCACTGCATGTAGTCCCTTTCCACCGATTTATAAGGAATTAAAGACAGTTAAAT / //// / / // / / / /// | |||| TsoI SetI |CviJI SspI | TspEI ||MseI | |||Csp6I BdaI MseI |AhaIII* | ||RsaI BdaI |SwaI | |MaeII TspEI | Tsp45I | MaeIII TaiI SetI L S R D V H Q G K V A K Y S L I S V N L C P V T Y I R E R W L N I P * F L S I * V P * R T S G K G G * I F L N F C Q F K ----:----|----:----|----:----|----:----|----:----|----:----| K D R S T C * P F T A L Y E K I E T L K K T G H R V D P F P P * I N R L K Q * N Q G T V Y M L S L H S F I G * N R D I * ApoI TspEI CviJI |SapI | TspDTI |Ksp632I* | | MboII SfeI* \\ \ \ \ \ AATAACGGGGAAGTCGTGTATGATGAATTTGAAGAGCCTAATCTTGCTGATGAGAAACTA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTGCCCCTTCAGCACATACTACTTAAACTTCTCGGATTAGAACGACTACTCTTTGAT / / / | | MboII | TspDTI | CviJI Ksp632I* TspEI ApoI SapI N N G E V V Y D E F E E P N L A D E K L I T G K S C M M N L K S L I L L M R N Y * R G S R V * * I * R A * S C * * E T T ----:----|----:----|----:----|----:----|----:----|----:----| F L P S T T Y S S N S S G L R A S S F S L Y R P L R T H H I Q L A * D Q Q H S V I V P F D H I I F K F L R I K S I L F * TatI XcmI MboII BsaBI |Csp6I | MboI |TfiI ||RsaI | | DpnI |HinfI SspI CviJI ||ScaI BsrI | | |BstKTI \\ \ \ \\\ \ \ \ \\ CAGATACGAATCAAATATTTACAGCCCATAGAAGTACTGGTAAATACAGATGATCTTCCA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| GTCTATGCTTAGTTTATAAATGTCGGGTATCTTCATGACCATTTATGTCTACTAGAAGGT / / / / / / /// / / // / | | | SspI CviJI | ||| BsrI MboII || MboI | | HinfI | ||TatI |DpnI | | TfiI | |Csp6I BstKTI | BsaBI | ScaI SfeI* | RsaI XcmI Q I R I K Y L Q P I E V L V N T D D L P R Y E S N I Y S P * K Y W * I Q M I F H D T N Q I F T A H R S T G K Y R * S S I ----:----|----:----|----:----|----:----|----:----|----:----| C I R I L Y K C G M S T S T F V S S R G V S V F * I N V A W L L V P L Y L H D E L Y S D F I * L G Y F Y Q Y I C I I K W FatI AflIII BspLU11I* |CviAII || NspI || NlaIII || | ApoI FatI || | TspEI |CviAII || | | XmnI || NlaIII || | | | TspDTI || | MseI \\ \ \ \ \ \\ \ \ TTACATGTAGCGAAATTTTTCAAAGATATTTCATGTCCTTTAATACACAAGCAGGAGTAT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| AATGTACATCGCTTTAAAAAGTTTCTATAAAGTACAGGAAATTATGTGTTCGTCCTCATA / // /// / // / | || ||TspDTI | |FatI MseI | || |TspEI | CviAII | || |ApoI NlaIII | || XmnI | |BspLU11I* | |AflIII | |FatI | CviAII NlaIII NspI L H V A K F F K D I S C P L I H K Q E Y Y M * R N F S K I F H V L * Y T S R S M T C S E I F Q R Y F M S F N T Q A G V * ----:----|----:----|----:----|----:----|----:----|----:----| N C T A F N K L S I E H G K I C L C S Y M V H L S I K * L Y K M D K L V C A P T * M Y R F K E F I N * T R * Y V L L L I MboI | DpnI | |FatI | |BstKTI BceAI | ||CviAII | ApoI | ||| NlaIII BdaI | TspEI | ||| | MboII BdaI | | TspDTI \ \\\ \ \ \ \ \ \ GATTTGGAAGATCATGTAGTTCAGGCAATAAAAGTAATGAATGAGAAAATTCAACTCTCG 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAACCTTCTAGTACATCAAGTCCGTTATTTTCATTACTTACTCTTTTAAGTTGAGAGC //// // / / / // |||| || MboII BdaI | |TspEI |||| |FatI BdaI | |ApoI |||| CviAII | TspDTI |||MboI BceAI ||NlaIII |DpnI BstKTI D L E D H V V Q A I K V M N E K I Q L S I W K I M * F R Q * K * * M R K F N S R F G R S C S S G N K S N E * E N S T L A ----:----|----:----|----:----|----:----|----:----|----:----| S K S S * T T * A I F T I F S F I * S E H N P L D H L E P L L L L S H S F E V R I Q F I M Y N L C Y F Y H I L F N L E R TatI BdaI |Csp6I BdaI ||RsaI | BsmAI ||| AarI | Esp3I DdeI DdeI NdeI ||| BspMI \ \ \ \ \ \\\ \ CCGTCTCTCATACGCTTAGTTTCTAAGTTATATTCGCATATGGTTGAGTACAATAATGAG 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| GGCAGAGAGTATGCGAATCAAAGATTCAATATAAGCGTATACCAACTCATGTTATTACTC / / / / / /// / BdaI Esp3I DdeI DdeI NdeI ||| BspMI BdaI BsmAI ||| AarI ||TatI |Csp6I RsaI P S L I R L V S K L Y S H M V E Y N N E R L S Y A * F L S Y I R I W L S T I M S V S H T L S F * V I F A Y G * V Q * * A ----:----|----:----|----:----|----:----|----:----|----:----| G D R M R K T E L N Y E C I T S Y L L S A T E * V S L K * T I N A Y P Q T C Y H R R E Y A * N R L * I R M H N L V I I L Hin4II* | SfaNI | | NdeI | | | Hin4I TfiI | | | |MaeIII HinfI | | | || BinI* SetI | HphI Hin4II* | | | || | MboI \ \ \ \ \ \ \ \\ \ \ CAGGTGATGTTGATTCCTTCTATCTATTCGCCCTTCGCATCAAAAATACATATGTTACTT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| GTCCACTACAACTAAGGAAGATAGATAAGCGGGAAGCGTAGTTTTTATGTATACAATGAA / // / / / / / / / SetI |HinfI Hin4II* | | | | | MaeIII |TfiI | | | | BinI* HphI | | | NdeI | | SfaNI | Hin4I Hin4II* Q V M L I P S I Y S P F A S K I H M L L R * C * F L L S I R P S H Q K Y I C Y L G D V D S F Y L F A L R I K N T Y V T * ----:----|----:----|----:----|----:----|----:----|----:----| C T I N I G E I * E G K A D F I C I N S A P S T S E K * R N A R R M L F V Y T V L H H Q N R R D I R G E C * F Y M H * K BccI | FatI | |CviAII | || NlaIII DpnI | || |MslI TsoI |BstKTI CviRI* Hin4I | || || BstXI SetI \\ \ \ \ \\ \\ \ \ GATCCTAACTCCCTGCAAAGTTTGGACATTTTTACCCATGATGGTGGTAAAGGTTCTTTG 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGGATTGAGGGACGTTTCAAACCTGTAAAAATGGGTACTACCACCATTTCCAAGAAAC // / / / // /// / / || MboI | Hin4I || ||MslI | TsoI |DpnI CviRI* || |FatI SetI BstKTI || CviAII || BstXI |NlaIII BccI D P N S L Q S L D I F T H D G G K G S L I L T P C K V W T F L P M M V V K V L C S * L P A K F G H F Y P * W W * R F F V ----:----|----:----|----:----|----:----|----:----|----:----| S G L E R C L K S M K V W S P P L P E K Q D * S G A F N P C K * G H H H Y L N K I R V G Q L T Q V N K G M I T T F T R Q AsuI* XmnI AvaII |TfiI |BmgT120I MseI |HinfI \\ \ \\ TTTTGGTTATTGGACCATACAAGGACATCGTTTGGATTAAGAATGTTGAGAGAATGGATT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| AAAACCAATAACCTGGTATGTTCCTGTAGCAAACCTAATTCTTACAACTCTCTTACCTAA // / / / |AvaII MseI | HinfI |AsuI* | TfiI BmgT120I XmnI F W L L D H T R T S F G L R M L R E W I F G Y W T I Q G H R L D * E C * E N G F L V I G P Y K D I V W I K N V E R M D S ----:----|----:----|----:----|----:----|----:----|----:----| N Q N N S W V L V D N P N L I N L S H I T K T I P G Y L S M T Q I L F T S L I S K P * Q V M C P C R K S * S H Q S F P N TatI Bsp1407I |Csp6I ||RsaI |||Hpy166II |||| FalI |||| FalI |||| | SapI |||| | TspEI |||| | Ksp632I* |||| | | SfaNI |||| | | | AciI |||| | | | BsrBI |||| | | | |BisI |||| | | | ||BlsI |||| | | | |||TauI |||| | | | |||CviJI FalI |||| | | | |||| MboII FalI SetI |||| | | | |||| | FokI |CviRI* \ \\\\ \ \ \ \\\\ \ \ \\ CTCAAACCTTTGGTTGATGTACACCAAATTGAAGAGCGGCTTGATGCCATTGAGTGCATT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| GAGTTTGGAAACCAACTACATGTGGTTTAACTTCTCGCCGAACTACGGTAACTCACGTAA / / /// // //// / / / / / SetI | ||| |TspEI |||| MboII | | | BseGI | ||| | |||CviJI | | CviRI* | ||| | ||BisI | FokI | ||| | ||AciI FalI | ||| | |SfaNI FalI | ||| | |BlsI | ||| | BsrBI | ||| | TauI | ||| Ksp632I* | ||| SapI | ||Bsp1407I | ||TatI | |Hpy166II | |Csp6I | RsaI FalI FalI L K P L V D V H Q I E E R L D A I E C I S N L W L M Y T K L K S G L M P L S A L Q T F G * C T P N * R A A * C H * V H Y ----:----|----:----|----:----|----:----|----:----|----:----| R L G K T S T C W I S S R S S A M S H M E * V K P Q H V G F Q L A A Q H W Q T C E F R Q N I Y V L N F L P K I G N L A N BseGI TfiI TfiI TfiI | Hpy188I Tsp4CI* HinfI HinfI HinfI \ \ \ \ \ \ ACATCCGAAATCAACAACAGTATATTTTTTGAATCGTTGAATCAAATGTTGAATCATACC 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| TGTAGGCTTTAGTTGTTGTCATATAAAAAACTTAGCAACTTAGTTTACAACTTAGTATGG / / / / / Hpy188I Tsp4CI* HinfI HinfI HinfI TfiI TfiI TfiI T S E I N N S I F F E S L N Q M L N H T H P K S T T V Y F L N R * I K C * I I P I R N Q Q Q Y I F * I V E S N V E S Y P ----:----|----:----|----:----|----:----|----:----|----:----| V D S I L L L I N K S D N F * I N F * V * M R F * C C Y I K Q I T S D F T S D Y C G F D V V T Y K K F R Q I L H Q I M G XbaI MseI Csp6I |MaeI MseI |AhaIII* |RsaI |Hpy178III* \ \\ \\ \\ CCTGACTTATTAAGAACTTTAAATCGCATAATGTATGGTACAACTTCTAGAAAAGAAGTC 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| GGACTGAATAATTCTTGAAATTTAGCGTATTACATACCATGTTGAAGATCTTTTCTTCAG / // // // MseI |MseI |Csp6I |XbaI AhaIII* RsaI Hpy178III* MaeI P D L L R T L N R I M Y G T T S R K E V L T Y * E L * I A * C M V Q L L E K K S * L I K N F K S H N V W Y N F * K R S L ----:----|----:----|----:----|----:----|----:----|----:----| G S K N L V K F R M I Y P V V E L F S T G Q S I L F K L D C L T H Y L K * F L L R V * * S S * I A Y H I T C S R S F F D MboI BclI | DpnI | SfaNI | |BstKTI | || Hpy178III* | || | CviRI* MseI | || | | EcoT22I |AhaIII* | || | | | SfaNI \\ \ \\ \ \ \ \ TATTTCTATTTAAAGCAAATAACTTCTTTCGTTGATCACTTCAAGATGCATCAATCTTAC 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| ATAAAGATAAATTTCGTTTATTGAAGAAAGCAACTAGTGAAGTTCTACGTAGTTAGAATG // // / / / / / / |MseI || | | | | CviRI* SetI AhaIII* || | | | EcoT22I || | | Hpy178III* || | SfaNI || BclI || MboI |DpnI BstKTI Y F Y L K Q I T S F V D H F K M H Q S Y I S I * S K * L L S L I T S R C I N L T F L F K A N N F F R * S L Q D A S I L P ----:----|----:----|----:----|----:----|----:----|----:----| * K * K F C I V E K T S * K L I C * D * R N R N L A F L K K R Q D S * S A D I K I E I * L L Y S R E N I V E L H M L R V BccI SetI | Hin4II* | Hpy188I | |Hpy188I \ \ \ \\ CTGTCAGAACATTTCAAGTCATCAGATGGAAGGATAGGCAAACAATCTCCTTTACTTTTT 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| GACAGTCTTGTAAAGTTCAGTAGTCTACCTTCCTATCCGTTTGTTAGAGGAAATGAAAAA / / / // | Hpy188I | |Hpy188I SfaNI | Hin4II* BccI L S E H F K S S D G R I G K Q S P L L F C Q N I S S H Q M E G * A N N L L Y F L V R T F Q V I R W K D R Q T I S F T F * ----:----|----:----|----:----|----:----|----:----|----:----| R D S C K L D D S P L I P L C D G K S K G T L V N * T M L H F S L C V I E K V K Q * F M E L * * I S P Y A F L R R * K K BspCNI |BseMII || MnlI TspDTI BdaI || | FatI TspEI | DdeI BdaI || | |CviAII \ \ \ \ \\ \ \\ AGACTATTTAGTGAATTGAATGAACTACTTTCTACCACTCAGTTGCCTCATTTTTTGACC 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| TCTGATAAATCACTTAACTTACTTGATGAAAGATGGTGAGTCAACGGAGTAAAAAACTGG / / / / // / / TspEI TspDTI | BdaI || | NlaIII | BdaI || MnlI DdeI |BseMII BspCNI R L F S E L N E L L S T T Q L P H F L T D Y L V N * M N Y F L P L S C L I F * P T I * * I E * T T F Y H S V A S F F D H ----:----|----:----|----:----|----:----|----:----|----:----| L S N L S N F S S S E V V * N G * K K V * V I * H I S H V V K * W E T A E N K S S * K T F Q I F * K R G S L Q R M K Q G MboI BclI |NlaIII ||DpnI |||BstKTI |||| AclI |||| MaeII AciI |||| | SetI | BdaI ApoI MseI |||| | TaiI | BdaI TspEI Hpy188I |TspEI \\\\ \ \ \ \ \ \ \\ ATGATCAACGTTTCTGCGGTAATGGAAAAAAATTCAGATAAGCAAGTAATGGATTTTTTT 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| TACTAGTTGCAAAGACGCCATTACCTTTTTTTAAGTCTATTCGTTCATTACCTAAAAAAA /// // / // // ||| || MaeII |AciI |Hpy188I ||| || AclI BdaI TspEI ||| |TaiI BdaI ApoI ||| |SetI ||| BclI ||| MboI ||DpnI |BstKTI |FatI CviAII M I N V S A V M E K N S D K Q V M D F F * S T F L R * W K K I Q I S K * W I F L D Q R F C G N G K K F R * A S N G F F * ----:----|----:----|----:----|----:----|----:----|----:----| M I L T E A T I S F F E S L C T I S K K W S * R K Q P L P F F N L Y A L L P N K H D V N R R Y H F F I * I L L Y H I K K MseI |SwaI ApoI TfiI |AhaIII* MnlI Hpy188I TspEI HinfI \\ \ \ \ \ AATTTAAATAACTATGATTGTTCAGAGGGTATAATAAAAATTCAAAGGGAAAGCGAATCA 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAATTTATTGATACTAACAAGTCTCCCATATTATTTTTAAGTTTCCCTTTCGCTTAGT / /// / / / / | ||MseI MnlI Hpy188I TspEI HinfI | |AhaIII* ApoI TfiI | |SwaI | TspEI MseI N L N N Y D C S E G I I K I Q R E S E S I * I T M I V Q R V * * K F K G K A N Q F K * L * L F R G Y N K N S K G K R I S ----:----|----:----|----:----|----:----|----:----|----:----| L K F L * S Q E S P I I F I * L S L S D * N L Y S H N N L P Y L L F E F P F R I I * I V I I T * L T Y Y F N L P F A F * Csp6I |RsaI || MaeIII || Tsp45I || Tsp4CI* MaeII || | Tsp4CI* | SetI || | | MseI TspEI MboII | TaiI \\ \ \ \ \ \ \ \ GTACGGTCACAGTTAAAGGAAGAATTGGCAGAAATACGAAAATATCTCAAACGTCCATAT 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| CATGCCAGTGTCAATTTCCTTCTTAACCGTCTTTATGCTTTTATAGAGTTTGCAGGTATA /// / / / / / / ||| | MseI | MboII | MaeII ||| Tsp4CI* TspEI TaiI ||| Tsp45I SetI ||| MaeIII ||Tsp4CI* |Csp6I RsaI V R S Q L K E E L A E I R K Y L K R P Y Y G H S * R K N W Q K Y E N I S N V H I T V T V K G R I G R N T K I S Q T S I S ----:----|----:----|----:----|----:----|----:----|----:----| T R D C N F S S N A S I R F Y R L R G Y L V T V T L P L I P L F V F I D * V D M Y P * L * L F F Q C F Y S F I E F T W I MseI ApoI |TspDTI TspEI TspEI || TaqI | MseI \ \\ \ \ \ CTAAATTTTAGAGATGAAGTTGATTACTTAATCGAAGTGAAAAACTCGCAAATTAAGGAC 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| GATTTAAAATCTCTACTTCAACTAATGAATTAGCTTCACTTTTTGAGCGTTTAATTCCTG / / / / // TspEI | | TaqI |MseI ApoI | MseI TspEI TspDTI L N F R D E V D Y L I E V K N S Q I K D * I L E M K L I T * S K * K T R K L R T K F * R * S * L L N R S E K L A N * G L ----:----|----:----|----:----|----:----|----:----|----:----| R F K L S S T S * K I S T F F E C I L S D L N * L H L Q N S L R L S F S A F * P * I K S I F N I V * D F H F V R L N L V MseI |HpaI |HindII |Hpy166II BstXI || BccI MboII \ \\ \ \ TTGCCAGATGATTGGATAAAAGTTAACAATACGAAGATGGTCAGTAGATTTACCACTCCC 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| AACGGTCTACTAACCTATTTTCAATTGTTATGCTTCTACCAGTCATCTAAATGGTGAGGG / // / / BstXI |MseI BccI MboII Hpy166II HindII HpaI L P D D W I K V N N T K M V S R F T T P C Q M I G * K L T I R R W S V D L P L P A R * L D K S * Q Y E D G Q * I Y H S Q ----:----|----:----|----:----|----:----|----:----|----:----| K G S S Q I F T L L V F I T L L N V V G S A L H N S L L * C Y S S P * Y I * W E Q W I I P Y F N V I R L H D T S K G S G MseI VspI |TspEI MlyI AluI || Hpy178III* PleI CviJI || | TfiI | AlwNI |MaeI || | HinfI | | HinfI ||SetI SspI || | | Hpy188I \ \ \ \\\ \ \\ \ \ \ AGAACCCAGAAACTGACTCAAAAGCTAGAATATTACAAGGACTTATTAATTCGGGAATCT 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTGGGTCTTTGACTGAGTTTTCGATCTTATAATGTTCCTGAATAATTAAGCCCTTAGA // / / / / / / / / // |PleI | | | | SspI | | | |Hpy188I AlwNI | | | MaeI | | | HinfI MlyI | | CviJI | | | TfiI | | AluI | | Hpy178III* | SetI | TspEI HinfI VspI MseI R T Q K L T Q K L E Y Y K D L L I R E S E P R N * L K S * N I T R T Y * F G N L N P E T D S K A R I L Q G L I N S G I * ----:----|----:----|----:----|----:----|----:----|----:----| L V W F S V * F S S Y * L S K N I R S D W F G S V S E F A L I N C P S I L E P I S G L F Q S L L * F I V L V * * N P F R BceAI |AluI |CviJI |Ecl136II || SetI ApoI || SduI TspEI || SacI EcoRI || HgiAI* SfeI* | Hpy178III* || HgiJII* | Tsp4CI* | | TspEI TspGWI || | TspEI \ \ \ \ \ \ \\ \ \ GAACTACAGTATAAAGAATTCTTGAACAAAATTACGGCAGAATATACAGAGCTCCGTAAA 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGATGTCATATTTCTTAAGAACTTGTTTTAATGCCGTCTTATATGTCTCGAGGCATTT // / / / / / // |SfeI* | | TspEI TspGWI | |BceAI Tsp4CI* | Hpy178III* | Ecl136II EcoRI | CviJI TspEI | AluI ApoI HgiJII* HgiAI* SacI SduI SetI E L Q Y K E F L N K I T A E Y T E L R K N Y S I K N S * T K L R Q N I Q S S V K T T V * R I L E Q N Y G R I Y R A P * N ----:----|----:----|----:----|----:----|----:----|----:----| S S C Y L S N K F L I V A S Y V S S R L Q V V T Y L I R S C F * P L I Y L A G Y F * L I F F E Q V F N R C F I C L E T F FatI |CviAII TseI || BbvI Hin6I |BisI || |CviRI* |GlaI ||BlsI || |NlaIII TspEI ||HhaI Tsp4CI* |||CviJI || || MaeII \ \\\ \ \\\\ \\ \\ \ ATTACACTCAATTTGGCGCAGTATGACTGTATTTTGTCGTTAGCAGCCACATCATGCAAC 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| TAATGTGAGTTAAACCGCGTCATACTGACATAAAACAGCAATCGTCGGTGTAGTACGTTG / / /// / /// / // // TspEI | ||Hin6I Tsp4CI* ||CviJI | || |BbvI | |GlaI ||TseI | || TaiI | HhaI |BisI | || SetI TspEI BlsI | |CviRI* | |FatI | CviAII NlaIII I T L N L A Q Y D C I L S L A A T S C N L H S I W R S M T V F C R * Q P H H A T Y T Q F G A V * L Y F V V S S H I M Q R ----:----|----:----|----:----|----:----|----:----|----:----| I V S L K A C Y S Q I K D N A A V D H L F * V * N P A T H S Y K T T L L W M M C N C E I Q R L I V T N Q R * C G C * A V SetI HindII MwoI TaiI Hpy166II BstAPI |TspEI | CviJI MwoI | CviRI* \\ \ \ \ \ \ GTAAATTATGTTAGACCAACTTTTGTGAATGGTCAACAAGCCATAATCGCAAAAAATGCA 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| CATTTAATACAATCTGGTTGAAAACACTTACCAGTTGTTCGGTATTAGCGTTTTTTACGT / / / / / / / MaeII TspEI | | MwoI | CviRI* | CviJI BstAPI Hpy166II MwoI HindII V N Y V R P T F V N G Q Q A I I A K N A * I M L D Q L L * M V N K P * S Q K M Q K L C * T N F C E W S T S H N R K K C K ----:----|----:----|----:----|----:----|----:----|----:----| T F * T L G V K T F P * C A M I A F F A R L N H * V L K Q S H D V L W L R L F H Y I I N S W S K H I T L L G Y D C F I C EcoRV TaqI | FatI | HinfI FokI | BspHI | | TspDTI Csp6I | |CviAII | | | PleI |RsaI | |Hpy178III* TspEI | | | |MlyI BseGI || BslFI | || NlaIII \ \ \ \ \\ \ \\ \ \ \\ \ AGAAATCCAATTATCGAGTCGCTGGATGTTCATTATGTACCAAATGATATCATGATGTCC 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTTAGGTTAATAGCTCAGCGACCTACAAGTAATACATGGTTTACTATAGTACTACAGG / // / / / // / / / / // | || HinfI | BseGI || FokI | | | |BspHI | |TspDTI PleI |Csp6I | | | |FatI | TaqI MlyI RsaI | | | Hpy178III* TspEI | | | CviAII | | NlaIII | EcoRV BslFI R N P I I E S L D V H Y V P N D I M M S E I Q L S S R W M F I M Y Q M I S * C P K S N Y R V A G C S L C T K * Y H D V P ----:----|----:----|----:----|----:----|----:----|----:----| L F G I I S D S S T * * T G F S I M I D L F D L * R T A P H E N H V L H Y * S T S I W N D L R Q I N M I Y W I I D H H G TaqII AsuI* |NlaIV |BmgT120I BsiYI* SspI ||CviJI | Tsp4CI* | PsiI ||HaeIII BsiYI* \ \ \ \ \\\ \ CCAGAAAACGGTAAAATCAATATTATAACGGGGCCGAATATGGGTGGGAAATCATCTTAT 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCTTTTGCCATTTTAGTTATAATATTGCCCCGGCTTATACCCACCCTTTAGTAGAATA / / / / / /// / | Tsp4CI* | | | ||| BsiYI* BsiYI* | | | ||AsuI* | | | |BmgT120I | | | |HaeIII | | | |CviJI | | | NlaIV | | TaqII | PsiI SspI P E N G K I N I I T G P N M G G K S S Y Q K T V K S I L * R G R I W V G N H L I R K R * N Q Y Y N G A E Y G W E I I L Y ----:----|----:----|----:----|----:----|----:----|----:----| G S F P L I L I I V P G F I P P F D D * G L F R Y F * Y * L P A S Y P H S I M K W F V T F D I N Y R P R I H T P F * R I BslFI |MboI || DpnI AciI || |BstKTI Ksp632I* BtsI TspRI || || CviJI | FauI \ \ \\ \\ \ \ \ ATTAGACAAGTGGCACTGCTTACTATAATGGCACAGATCGGCTCATTTGTCCCCGCAGAA 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| TAATCTGTTCACCGTGACGAATGATATTACCGTGTCTAGCCGAGTAAACAGGGGCGTCTT / //// / // TspRI |||| CviJI |Ksp632I* BtsI |||MboI AciI ||BslFI |DpnI BstKTI I R Q V A L L T I M A Q I G S F V P A E L D K W H C L L * W H R S A H L S P Q K * T S G T A Y Y N G T D R L I C P R R R ----:----|----:----|----:----|----:----|----:----|----:----| I L C T A S S V I I A C I P E N T G A S Y * V L P V A * * L P V S R S M Q G R L N S L H C Q K S Y H C L D A * K D G C F MboI | DpnI MaeII Hin6I | |BstKTI | Csp6I |GlaI | || Hpy188I | |RsaI TaqI |MstI* | || | MseI | |SetI | TfiI |FspAI | || | MboII | |TaiI | HinfI ||HhaI \ \\ \ \ \ \\ \ \ \\\ GAGATCAGATTAAGCATATTTGAAAACGTACTCACTCGAATCGGTGCGCACGATGATATT 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTAGTCTAATTCGTATAAACTTTTGCATGAGTGAGCTTAGCCACGCGTGCTACTATAA /// / / / / /// / / /// ||| | | MseI | ||Csp6I | | ||Hin6I ||| | MboII | |RsaI | | |FspAI ||| Hpy188I | MaeII | | |MstI* ||| MboI TaiI | | |GlaI ||DpnI SetI | | HhaI |BstKTI | HinfI FauI | TfiI TaqI E I R L S I F E N V L T R I G A H D D I R S D * A Y L K T Y S L E S V R T M I L D Q I K H I * K R T H S N R C A R * Y Y ----:----|----:----|----:----|----:----|----:----|----:----| S I L N L M N S F T S V R I P A C S S I L S * I L C I Q F R V * E F R H A R H Y L D S * A Y K F V Y E S S D T R V I I N Tsp4CI* HphI | TfiI |MseI Hpy178III* PsiI | HinfI ||AhaIII* EcoRV | TspEI \ \ \ \\\ \ \ \ ATAAACGGTGATTCTACTTTTAAAGTGGAAATGCTTGATATCCTACACATCTTGAAAAAT 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| TATTTGCCACTAAGATGAAAATTTCACCTTTACGAACTATAGGATGTGTAGAACTTTTTA / / / / // / / PsiI | | | |MseI EcoRV Hpy178III* | | | AhaIII* | | HphI | HinfI | TfiI Tsp4CI* I N G D S T F K V E M L D I L H I L K N * T V I L L L K W K C L I S Y T S * K I K R * F Y F * S G N A * Y P T H L E K L ----:----|----:----|----:----|----:----|----:----|----:----| I F P S E V K L T S I S S I R C M K F F * L R H N * K * L P F A Q Y G V C R S F Y V T I R S K F H F H K I D * V D Q F I MboII Csp6I |BsrI Ksp632I* |RsaI ||BccI CviRI* Tsp4CI* |MnlI |SetI ||Cac8I \ \ \\ \\ \\\ TGCAATAAACGGTCTTTACTATTATTAGACGAAGTGGGAAGAGGTACTGGCACGCACGAT 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| ACGTTATTTGCCAGAAATGATAATAATCTGCTTCACCCTTCTCCATGACCGTGCGTGCTA // / / / / // / // |CviRI* Tsp4CI* | | | || | |BccI TspEI | | | || | Cac8I | | | || MboII | | | || BsrI | | | |Csp6I | | | RsaI | | SetI | Ksp632I* MnlI C N K R S L L L L D E V G R G T G T H D A I N G L Y Y Y * T K W E E V L A R T M Q * T V F T I I R R S G K R Y W H A R W ----:----|----:----|----:----|----:----|----:----|----:----| Q L L R D K S N N S S T P L P V P V C S N C Y V T K V I I L R L P F L Y Q C A R A I F P R * * * * V F H S S T S A R V I DdeI |Hpy188I || MseI BseMII || | MaeIII TspEI MseI |BspCNI || | Tsp45I \ \ \\ \\ \ \ GGTATAGCAATTTCTTATGCTTTAATAAAGTATTTTTCTGAGTTAAGTGACTGCCCCTTG 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| CCATATCGTTAAAGAATACGAAATTATTTCATAAAAAGACTCAATTCACTGACGGGGAAC / / // / / / / TspEI | |BspCNI | | MseI Tsp45I | BseMII | DdeI MaeIII MseI Hpy188I G I A I S Y A L I K Y F S E L S D C P L V * Q F L M L * * S I F L S * V T A P * Y S N F L C F N K V F F * V K * L P L D ----:----|----:----|----:----|----:----|----:----|----:----| P I A I E * A K I F Y K E S N L S Q G K H Y L L K K H K L L T N K Q T L H S G R T Y C N R I S * Y L I K R L * T V A G Q FatI |CviAII || BseYI || NlaIII || |BsiYI* || || GsaI || || | TspGWI MseI TspEI \\ \\ \ \ \ \ ATATTATTTACTACCCATTTTCCCATGCTGGGAGAAATCAAATCTCCGTTAATAAGGAAT 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| TATAATAAATGATGGGTAAAAGGGTACGACCCTCTTTAGTTTAGAGGCAATTATTCCTTA / /// / / / | ||| | TspGWI MseI | ||| BseYI | ||FatI | ||GsaI | |CviAII | BsiYI* NlaIII I L F T T H F P M L G E I K S P L I R N Y Y L L P I F P C W E K S N L R * * G I I I Y Y P F S H A G R N Q I S V N K E L ----:----|----:----|----:----|----:----|----:----|----:----| I N N V V W K G M S P S I L D G N I L F S I I * * G N E W A P L F * I E T L L S Y * K S G M K G H Q S F D F R R * Y P I MaeII BsrI |BsaAI MnlI | BseGI || SetI |MboII | | TspEI NdeI || TaiI || BsrI | | | FokI \ \\ \ \\ \ \ \ \ \ TATCATATGGATTACGTGGAAGAACAAAAAACTGGCGAGGACTGGATGAGTGTAATTTTT 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| ATAGTATACCTAATGCACCTTCTTGTTTTTTGACCGCTCCTGACCTACTCACATTAAAAA / / / // // / / / / TspEI NdeI | |MaeII || BsrI | BseGI TspEI | BsaAI |MboII BsrI TaiI MnlI SetI Y H M D Y V E E Q K T G E D W M S V I F I I W I T W K N K K L A R T G * V * F F S Y G L R G R T K N W R G L D E C N F S ----:----|----:----|----:----|----:----|----:----|----:----| * * I S * T S S C F V P S S Q I L T I K N D Y P N R P L V F F Q R P S S S H L K I M H I V H F F L F S A L V P H T Y N K FokI |TspEI || MwoI MseI PsiI BseGI || TspDTI \ \ \ \\ \ CTATATAAGTTAAAAAAGGGATTGACTTATAATAGTTATGGGATGAATGTGGCGAAATTG 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| GATATATTCAATTTTTTCCCTAACTGAATATTATCAATACCCTACTTACACCGCTTTAAC / / / / // // FokI MseI PsiI BseGI || |TspEI || FokI |TspDTI MwoI L Y K L K K G L T Y N S Y G M N V A K L Y I S * K R D * L I I V M G * M W R N W I * V K K G I D L * * L W D E C G E I G ----:----|----:----|----:----|----:----|----:----|----:----| R Y L N F F P N V * L L * P I F T A F N E I Y T L F P I S K Y Y N H S S H P S I * I L * F L S Q S I I T I P H I H R F Q Cac8I Hpy188I | BssKI | TspEI | EcoRII | | Hin4II* | | ScrFI | | | AciI | | BseBI PsiI BsmI | | | | MboII \ \ \ \ \ \ \ \ \ \ GCACGCCTGGACAAAGATATTATAAATCGGGCATTCAGTATTTCAGAAGAATTGCGGAAG 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| CGTGCGGACCTGTTTCTATAATATTTAGCCCGTAAGTCATAAAGTCTTCTTAACGCCTTC / / / / / / / / // | | EcoRII PsiI BsmI | | | |MboII | | BssKI | | | AciI | BseBI | | TspEI | ScrFI | Hin4II* Cac8I Hpy188I A R L D K D I I N R A F S I S E E L R K H A W T K I L * I G H S V F Q K N C G R T P G Q R Y Y K S G I Q Y F R R I A E G ----:----|----:----|----:----|----:----|----:----|----:----| A R R S L S I I F R A N L I E S S N R F P V G P C L Y * L D P M * Y K L L I A S C A Q V F I N Y I P C E T N * F F Q P L MluI AflIII | FnuDII* | |BbvII* | || HgaI BdaI MseI | || TspEI AluI BdaI TfiI | BdaI | || MboII CviJI | SspI HinfI | BdaI | || | XmnI | SetI | | MseI \ \ \ \ \\ \ \ \ \ \ \ \ GAATCCATTAACGAAGACGCGTTGAAATTATTCAGCTCTTTGAAAAGAATATTAAAAAGT 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAGGTAATTGCTTCTGCGCAACTTTAATAAGTCGAGAAACTTTTCTTATAATTTTTCA / / / / / /// / / / / / HinfI MseI | | | ||| | CviJI BdaI | MseI TfiI BdaI | | | ||| | AluI BdaI SspI BdaI | | | ||| SetI | | | ||HgaI | | | |TspEI | | | XmnI | | BbvII* | | MboII | AflIII | MluI FnuDII* E S I N E D A L K L F S S L K R I L K S N P L T K T R * N Y S A L * K E Y * K V I H * R R R V E I I Q L F E K N I K K * ----:----|----:----|----:----|----:----|----:----|----:----| S D M L S S A N F N N L E K F L I N F L P I W * R L R T S I I * S K S F F I L F F G N V F V R Q F * E A R Q F S Y * F T Hpy178III* |NruI |FnuDII* || TspEI || TspGWI EcoRV \\ \ \ GATAATATAACAGCAACGGATAAACTCGCGAAATTACTATCATTGGATATCCACTGA 3010 3020 3030 3040 3050 ----:----|----:----|----:----|----:----|----:----|----:-- CTATTATATTGTCGTTGCCTATTTGAGCGCTTTAATGATAGTAACCTATAGGTGACT // / / || TspEI EcoRV |Hpy178III* |TspGWI FnuDII* NruI D N I T A T D K L A K L L S L D I H * I I * Q Q R I N S R N Y Y H W I S T X * Y N S N G * T R E I T I I G Y P L X ----:----|----:----|----:----|----:----|----:----|----:-- S L I V A V S L S A F N S D N S I W Q H Y Y L L L P Y V R S I V I M P Y G S I I Y C C R I F E R F * * * Q I D V S # Enzymes that cut Frequency Isoschizomers AarI 1 AciI 7 BspACI,SsiI AclI 2 Psp1406I AflIII 2 AhaIII* 6 DraI AjuI 1 AluI 6 AluBI AlwNI 1 CaiI ApoI 9 AcsI,XapI AsuI* 3 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 5 Bce83I* 1 BpuEI BceAI 3 BclI 2 FbaI,Ksp22I BdaI 8 BinI* 2 AlwI,BspPI,AclWI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmgT120I 3 BsaAI 1 BstBAI,Ppu21I BsaBI 2 Bse8I,BseJI BseBI 3 Bst2UI,BstNI,BstOI,MvaI BseGI 6 BstF5I,BtsCI BseMII 2 BseYI 1 BsiYI* 4 Bsc4I,BseLI,BslI,AfiI BslFI 5 BsmFI,FaqI BsmAI 2 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI Bsp1407I 1 BsrGI,BstAUI BspCNI 2 BspHI 1 CciI,PagI,RcaI BspLU11I* 1 PscI,PciI BspMI 2 BfuAI,Acc36I,BveI BsrBI 1 AccBSI,MbiI BsrI 4 BseNI,Bse1I,BsrSI BssKI 4 BstSCI,StyD4I BstAPI 2 BstKTI 8 BstXI 2 BtsI 2 Cac8I 5 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 12 CviQI,RsaNI CviAII 9 CviJI 18 CviKI-1 CviRI* 12 HpyCH4V DdeI 6 BstDEI,HpyF3I DpnI 8 MalI DraII 1 EcoO109I DsaI* 1 BtgI,BstDSI Ecl136II 1 EcoICRI Eco47III 1 Aor51HI,AfeI Eco57I 1 AcuI Eco57MI 1 EcoRI 2 EcoRII 3 AjnI,Psp6I,PspGI EcoRV 3 Eco32I EcoT22I 2 Mph1103I,NsiI,Zsp2I Esp3I 1 BsmBI FalI 2 FatI 9 FauI 1 SmuI FnuDII* 2 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 6 FspAI 1 GlaI 4 GsaI 1 HaeII 2 BstH2I HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 4 BstHHI,CfoI,AspLEI Hin4I 3 Hin4II* 6 HpyAV Hin6I 4 HinP1I,HspAI HindII 2 HincII HinfI 15 HpaI 1 KspAI HpaII 1 HapII,BsiSI,MspI HphI 6 AsuHPI Hpy166II 4 Hpy8I Hpy178III* 9 Hpy188III Hpy188I 12 Ksp632I* 6 Eam1104I,EarI,Bst6I MaeI 4 FspBI,BfaI,XspI MaeII 8 HpyCH4IV MaeIII 6 MboI 8 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 17 MluI 1 MlyI 3 SchI MmeI 1 MnlI 11 MseI 27 Tru1I,Tru9I MslI 1 RseI,SmiMI MstI* 1 AviII,FspI,NsbI,Acc16I MwoI 6 HpyF10VI,BstMWI NdeI 3 FauNDI NlaIII 9 Hin1II,Hsp92II,FaeI NlaIV 2 BspLI,BmiI,PspN4I NruI 1 BtuMI,Bsp68I NspI 1 BstNSI,XceI PfoI 1 PleI 3 PpsI PpuMI 1 Psp5II,PspPPI PsiI 4 AanI RsaI 12 AfaI SacI 1 Psp124BI,SstI SapI 2 LguI,PciSI,BspQI SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScaI 1 BmcAI,AssI,ZrmI ScrFI 4 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 2 BseDI,BssECI,BsaJI SetI 27 SfaNI 7 LweI SfeI* 3 BstSFI,SfcI,BfmI SmlI 1 SmoI SpeI 1 BcuI,AhlI SspI 5 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I SwaI 2 SmiI TaiI 8 TaqI 6 TaqII 1 TatI 4 TauI 1 TfiI 12 PfeI TseI 1 ApeKI TsoI 2 Tsp45I 3 NmuCI Tsp4CI* 12 HpyCH4III,TaaI,Bst4CI TspDTI 10 TspEI 35 TasI,Tsp509I,Sse9I TspGWI 3 TspRI 3 TscAI VspI 1 PshBI,AseI XbaI 1 XcmI 1 XmnI 4 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AatII AbsI Acc65I AccI AcyI AflII AgeI AlfI AloI ApaI ApaLI AscI Asp718I AvaI AvrII BaeI BalI BamHI BarI BbvCI BcgI BciVI BetI* BfiI BglI BglII BmeT110I BmtI BplI Bpu10I BsaXI BsePI BseRI BseSI BsgI BsiI* Bsp120I BspMII* BspOI BsrDI BssNAI Bst1107I BstEII BstZ17I BtgZI BtrI Cfr10I Cfr9I CfrI CspCI DinI DraIII DrdI Eam1105I EciI Eco31I EcoNI EcoP15I EgeI EheI EspI* FseI GsuI HindIII Hpy99I KasI KpnI MauBI McrI* MfeI MroNI NaeI NarI NcoI NgoMIV NheI NmeAIII NotI NspBII* OliI PacI PasI PflMI PmaCI PmeI PpiI PshAI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacII SalI SanDI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SphI SplI* SrfI Sse232I* Sse8387I StuI TspMI TstI Tth111I XhoI XhoII XmaCI XmaI XmaIII* ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769