Restriction Map of PAT1/YCR077C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

PAT1/YCR077C on chromosome III from coordinates 252628 to 250238.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.23082

EMBOSS_001 BccI Hin6I |GlaI ||AciI ||HhaI ||FnuDII* ||| AsuI* ||| AvaII ||| |BmgT120I ||| ||BseGI ||| ||| Hpy178III* ||| ||| | FokI BsiYI* AciI ||| ||| | |Ksp632I* | Hin4II* | FauI ||| ||| | || MnlI \ \ \ \ \\\ \\\ \ \\ \ ATGTCCTTCTTTGGGTTAGAAAATAGCGGTAATGCGCGGGATGGTCCTCTGGACTTTGAA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGGAAGAAACCCAATCTTTTATCGCCATTACGCGCCCTACCAGGAGACCTGAAACTT / / / / /// / / // / // | Hin4II* | | ||| AciI | || | |Ksp632I* BsiYI* | | ||| | || | |FokI | | ||| | || | MnlI | | ||| | || Hpy178III* | | ||| | |AvaII | | ||| | |AsuI* | | ||| | BmgT120I | | ||| BseGI | | ||FnuDII* | | ||Hin6I | | |GlaI | | |BccI | | HhaI | FauI AciI M S F F G L E N S G N A R D G P L D F E C P S L G * K I A V M R G M V L W T L K V L L W V R K * R * C A G W S S G L * R ----:----|----:----|----:----|----:----|----:----|----:----| X D K K P N S F L P L A R S P G R S K S X T R R Q T L F Y R Y H A P H D E P S Q H G E K P * F I A T I R P I T R Q V K F Cac8I BseRI | SduI | Bce83I* MaeIII | HgiAI* | | BdaI | MboII | |MnlI | | BdaI | | CviJI | || SmlI | | Hpy99I \ \ \ \ \\ \ \ \ \ GAGAGTTACAAGGGCTATGGCGAGCACGAACTTGAGGAGAACGACTATTTGAACGACGAA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTCAATGTTCCCGATACCGCTCGTGCTTGAACTCCTCTTGCTGATAAACTTGCTGCTT / / / / / / / / / | CviJI | MnlI SmlI | | | BdaI MaeIII HgiAI* | | | BdaI MboII Cac8I | | Hpy99I SduI | Bce83I* BseRI E S Y K G Y G E H E L E E N D Y L N D E R V T R A M A S T N L R R T T I * T T K E L Q G L W R A R T * G E R L F E R R N ----:----|----:----|----:----|----:----|----:----|----:----| S L * L P * P S C S S S S F S * K F S S L S N C P S H R A R V Q P S R S N S R R L T V L A I A L V F K L L V V I Q V V F HphI | SetI | | Acc65I | | HgiCI* TseI | | |Csp6I |BisI | | ||RsaI ||BlsI | | ||NlaIV |||AciI | | ||| KpnI |||MnlI | | ||| | BdaI |||NspBII* | | ||| | BdaI ||||BisI \ \ \\\ \ \ \\\\\ ACATTTGGTGATAATGTTCAGGTTGGTACCGACTTTGATTTTGGAAATCCTCACAGCAGC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TGTAAACCACTATTACAAGTCCAACCATGGCTGAAACTAAAACCTTTAGGAGTGTCGTCG // / //// //// |SetI | |||BdaI |||BlsI HphI | |||BdaI ||NspBII* | ||HgiCI* ||MwoI | ||Acc65I ||TseI | |Csp6I ||TauI | NlaIV |MnlI | RsaI |BisI KpnI BlsI T F G D N V Q V G T D F D F G N P H S S H L V I M F R L V P T L I L E I L T A A I W * * C S G W Y R L * F W K S S Q Q R ----:----|----:----|----:----|----:----|----:----|----:----| V N P S L T * T P V S K S K P F G * L L F M Q H Y H E P Q Y R S Q N Q F D E C C C K T I I N L N T G V K I K S I R V A A BlsI |TseI |TauI |MwoI ||BisI |||BlsI ||||TseI ||||MwoI |||||BisI ||||||BlsI |||||||AciI AcyI |||||||MwoI |EcoP15I |||||||BbvI || HgiCI* |||||||NspBII* || Hpy99I ||||||||BisI || | NlaIV |||||||||BlsI || | | SecI* ||||||||||TauI || | | DsaI* ||||||||||| BbvI || | | | CviJI ||||||||||| | MfeI || | | | |MaeI ||||||||||| | BbvI || | | | || MboI ||||||||||| | TspEI || | | | || | DpnI ||||||||||| | | HgaI || | | | || | |BstKTI ||||||||||| | | | EcoP15I || | | | || | || NdeI BceAI \\\\\\\\\\\ \ \ \ \ \\ \ \ \ \\ \ \\ \ \ GGCAGCAGCGGCAACGCAATTGGTGGTAATGGCGTCGGTGCCACGGCTAGATCATATGTT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CCGTCGTCGCCGTTGCGTTAACCACCATTACCGCAGCCACGGTGCCGATCTAGTATACAA ////////// / / / / / // / / // /// / / |||||||||| BbvI | | | | || | | || ||| | NdeI |||||||||BisI | | | | || | | || ||| MboI |||||||||AciI | | | | || | | || ||DpnI ||||||||BlsI | | | | || | | || |BstKTI |||||||NspBII* | | | | || | | || MaeI |||||||TseI | | | | || | | |CviJI |||||||TauI | | | | || | | DsaI* ||||||BisI | | | | || | | SecI* |||||BlsI | | | | || | HgiCI* ||||MwoI | | | | || NlaIV ||||TseI | | | | |EcoP15I |||BisI | | | | AcyI ||BlsI | | | Hpy99I |MwoI | | EcoP15I BisI | | HgaI AciI | TspEI | BbvI | MfeI BbvI G S S G N A I G G N G V G A T A R S Y V A A A A T Q L V V M A S V P R L D H M L Q Q R Q R N W W * W R R C H G * I I C C ----:----|----:----|----:----|----:----|----:----|----:----| P L L P L A I P P L P T P A V A L D Y T R C C R C R L Q H Y H R R H W P * I M H A A A A V C N T T I A D T G R S S * I N TseI AciI TseI CviRI* |BisI |BisI |BisI ||BlsI ||BlsI ||BlsI ||AsuI* |||TseI |||AluI |||TauI |||TaqII |||CviJI |||CviJI ||||BisI |||| SetI |||HaeIII |||||BlsI |||| |MwoI |||BmgT120I |||||| AsuI* |||| |AlwNI |||| StyI |||||| AvaII |||| |BstAPI |||| AvrII |||||| DraII |||| |Hin4II* |||| SecI* |||||| PpuMI |||| ||SfeI* |||| |MaeI |||||| |BmgT120I |||| ||| CviRI* |||| || BccI |||||| || BbvI |||| ||| | PstI |||| || |AsuI* |||||| || |BceAI |||| ||| | |BbvI |||| || |AvaII |||||| || ||XbaI |||| ||| | || TspEI |||| || ||BmgT120I |||||| || ||SetI \\\\ \\\ \ \\ \ \\\\ \\ \\\ \\\\\\ \\ \\\ GCAGCTACTGCAGAAGGAATTAGCGGCCCTAGGACCGATGGAACGGCAGCAGCAGGACCT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CGTCGATGACGTCTTCCTTAATCGCCGGGATCCTGGCTACCTTGCCGTCGTCGTCCTGGA //// / / / / / / ////// // // ////// /// |||| | | | | | | |||||| || |AvaII |||||| ||PpuMI |||| | | | | | | |||||| || |AsuI* |||||| ||DraII |||| | | | | | | |||||| || BmgT120I |||||| ||AvaII |||| | | | | | | |||||| |SecI* |||||| ||AsuI* |||| | | | | | | |||||| |AvrII |||||| |BmgT120I |||| | | | | | | |||||| |StyI |||||| SetI |||| | | | | | | |||||| |BccI |||||TseI |||| | | | | | | |||||| MaeI ||||BisI |||| | | | | | | |||||AsuI* |||BlsI |||| | | | | | | ||||BmgT120I ||TseI |||| | | | | | | |||HaeIII |BisI |||| | | | | | | |||CviJI TaqII |||| | | | | | | ||BisI BlsI |||| | | | | | | ||AciI |||| | | | | | | |BlsI |||| | | | | | | TauI |||| | | | | | TspEI |||| | | | | BbvI |||| | | | SfeI* |||| | | CviRI* |||| | PstI |||| Hin4II* |||BstAPI |||AlwNI |||CviJI |||MwoI |||TseI |||AluI ||BisI |BlsI |SetI CviRI* BceAI A A T A E G I S G P R T D G T A A A G P Q L L Q K E L A A L G P M E R Q Q Q D L S Y C R R N * R P * D R W N G S S R T S ----:----|----:----|----:----|----:----|----:----|----:----| A A V A S P I L P G L V S P V A A A P G Q L * Q L L F * R G * S R H F P L L L V C S S C F S N A A R P G I S R C C C S R HphI MaeI MnlI BbvI |KasI Hpy178III* |HgiCI* | SetI Eco57I ||AcyI | MnlI Eco57MI ||NarI | | TstI |GsuI ||Hin6I | | | CviJI |Eco57MI |||GlaI | | | | EcoP15I || AccI |||DinI | | | | | TfiI || |Hpy166II |||NlaIV | | | | | HinfI || || CviRI* |||BsrDI | | | | | |BsgI || || | TstI ||||HhaI | | | | | |EcoP15I || || | | SetI |||||HaeII \ \ \ \ \ \\ \\ \\ \ \ \ \\\\\\ CTAGACCTGAAGCCAATGGAATCTTTGTGGTCTACTGCACCACCTCCAGCAATGGCGCCT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GATCTGGACTTCGGTTACCTTAGAAACACCAGATGACGTGGTGGAGGTCGTTACCGCGGA ///// / / // / // // / / / ///// / ||||| MnlI CviJI || | || || | SetI | ||||| BsaXI ||||BbvI || | || || CviRI* | ||||HgiCI* ||||TstI || | || || TstI | ||||KasI |||XbaI || | || |AccI | |||Hin6I |||SetI || | || Hpy166II | |||NarI ||Hpy178III* || | |Eco57MI | |||AcyI ||MaeI || | |GsuI | ||NlaIV |BbvI || | Eco57MI | ||DinI BceAI || | Eco57I | ||GlaI || EcoP15I | |HhaI || HinfI | BsrDI || TfiI | HaeII |EcoP15I MnlI BsgI HphI L D L K P M E S L W S T A P P P A M A P * T * S Q W N L C G L L H H L Q Q W R L R P E A N G I F V V Y C T T S S N G A F ----:----|----:----|----:----|----:----|----:----|----:----| R S R F G I S D K H D V A G G G A I A G E L G S A L P I K T T * Q V V E L L P A * V Q L W H F R Q P R S C W R W C H R R AsuI* |CviJI |HaeIII |BmgT120I BsaXI CviJI BsaXI ||NlaIV | Hin4II* |NlaIV |AciI |||BbvI | | TatI || HpaII || TseI |||| SfeI* | | |Csp6I || | CviJI || |BisI |||| | CviJI | | ||RsaI || | |NlaIV || ||BlsI |||| | | SfaNI \ \ \\\ \\ \ \\ \\ \\\ \\\\ \ \ \ TCACCCCAAAGTACAATGGCTCCGGCTCCTGCTCCGCAGCAAATGGCCCCCCTACAGCCA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AGTGGGGTTTCATGTTACCGAGGCCGAGGACGAGGCGTCGTTTACCGGGGGGATGTCGGT / /// // /// / //// /// / // | ||TatI || ||| BsaXI |||TseI ||| | |CviJI | |Csp6I || ||NlaIV ||BisI ||| | SfeI* | RsaI || |CviJI |BlsI ||| BbvI Hin4II* || HpaII AciI ||AsuI* |NlaIV |BmgT120I CviJI |NlaIV HaeIII CviJI S P Q S T M A P A P A P Q Q M A P L Q P H P K V Q W L R L L L R S K W P P Y S Q T P K Y N G S G S C S A A N G P P T A N ----:----|----:----|----:----|----:----|----:----|----:----| E G W L V I A G A G A G C C I A G R C G K V G F Y L P E P E Q E A A F P G G V A * G L T C H S R S R S R L L H G G * L W DrdI TseI Tsp4CI* |MaeII CviRI* | BbvI || SetI |BisI | | ApoI TaqI CviRI* || TaiI ||BlsI | | TspEI \ \ \\ \ \\\ \ \ \ ATCTTGTCGATGCAAGACTTGGAAAGACAACAACGTCAAATGCAGCAACAGTTTATGAAT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TAGAACAGCTACGTTCTGAACCTTTCTGTTGTTGCAGTTTACGTCGTTGTCAAATACTTA / / / / / / //// / / SfaNI | CviRI* | | MaeII |||| Tsp4CI* BbvI TaqI | TaiI |||TseI | SetI ||BisI DrdI |BlsI CviRI* I L S M Q D L E R Q Q R Q M Q Q Q F M N S C R C K T W K D N N V K C S N S L * I L V D A R L G K T T T S N A A T V Y E F ----:----|----:----|----:----|----:----|----:----|----:----| I K D I C S K S L C C R * I C C C N I F L R T S A L S P F V V V D F A A V T * S D Q R H L V Q F S L L T L H L L L K H I EciI | BsmAI | Eco31I | | AsuI* | | AvaII | | |NlaIV | | |BmgT120I | | || AciI | | || |BsaXI | | || || TstI FatI | | || || |DdeI NcoI | | || || |BbvCI StyI | | || || |Bpu10I SecI* | | || || || TseI DsaI* | | || || || MwoI |PflMI | | || || || |BisI |CviAII | | || || || ||BlsI |BsiYI* | | || || || ||| TspEI ||TspDTI | | || || || ||| |MnlI |||TstI | | || || || ||| || BspCNI |||BsaXI | | || || || ||| || |BseMII ||||NlaIII | | || || || ||| || ||HgaI FokI ||||| BseGI | | || || || ||| || |||BbvI \ \\\\\ \ \ \ \\ \\ \\ \\\ \\ \\\\ TTCCACGCCATGGGTCATCCACAGGGTCTCCCACAGGGTCCGCCTCAGCAGCAATTTCCA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| AAGGTGCGGTACCCAGTAGGTGTCCCAGAGGGTGTCCCAGGCGGAGTCGTCGTTAAAGGT / / / /// / / /// / / / //// // | | | ||BseGI EciI | ||| | | | |||| |BseMII | | | |DsaI* | ||| | | | |||| |TspEI | | | |SecI* | ||| | | | |||| BspCNI | | | |StyI | ||| | | | |||MnlI | | | |NcoI | ||| | | | ||TseI | | | |FatI | ||| | | | |BisI | | | CviAII | ||| | | | BlsI | | TspDTI | ||| | | Bpu10I | | NlaIII | ||| | | BbvCI | | BsaXI | ||| | | DdeI | BsiYI* | ||| | MwoI | PflMI | ||| AciI | TstI | ||AvaII | FokI | ||AsuI* TspEI | |BmgT120I ApoI | BsaXI | NlaIV | TstI Eco31I BsmAI F H A M G H P Q G L P Q G P P Q Q Q F P S T P W V I H R V S H R V R L S S N F Q P R H G S S T G S P T G S A S A A I S N ----:----|----:----|----:----|----:----|----:----|----:----| K W A M P * G C P R G C P G G * C C N G N G R W P D D V P D G V P D A E A A I E E V G H T M W L T E W L T R R L L L K W TseI CviRI* |BisI ||BlsI |||CviJI |||| Cac8I |||| | BslFI |||| | | BsiYI* |||| | | | BbvI |||| | | | Hpy99I |||| | | | |EcoP15I |||| | | | || HindII |||| | | | || Hpy166II |||| | | | || | BssKI |||| | | | || | SexAI |||| | | | || | EcoRII |||| | | | || | | ScrFI |||| | | | || | | BseBI |||| | | | || | | | AsuI* SetI |||| | | | || | | | AvaII | MnlI |||| | | | || | | | DraII | | SetI |||| | | | || | | | PpuMI | | BssKI |||| | | | || | | | |BmgT120I | | EcoRII |||| | | | || | | | || TspEI | | |PflMI |||| | | | || | | | || | MnlI | | |BsiYI* |||| | | | || | | | || | |Hin6I | | ||MnlI |||| | | | || | | | ||SetI | ||GlaI | | ||ScrFI |||| | | | || | | | ||NlaIV | |||HhaI | | ||BseBI \\\\ \ \ \ \\ \ \ \ \\\ \ \\\\ \ \ \\\ ATGCAGCCTGCGTCGGGTCAACCAGGTCCCTCACAATTTGCGCCTCCACCTCCACCTCCT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TACGTCGGACGCAGCCCAGTTGGTCCAGGGAGTGTTAAACGCGGAGGTGGAGGTGGAGGA //// / / / // // /// / /// / // / / / |||| | | | || || ||PpuMI | ||| SetI || | | BseBI |||| | | | || || ||DraII | ||Hin6I || | | ScrFI |||| | | | || || ||AvaII | |GlaI || | MnlI |||| | | | || || ||AsuI* | HhaI || BsiYI* |||| | | | || || |BmgT120I TspEI || PflMI |||| | | | || || |NlaIV MnlI |SetI |||| | | | || || EcoRII MnlI |||| | | | || || SexAI |||| | | | || || BssKI |||| | | | || |BseBI |||| | | | || |ScrFI |||| | | | || SetI |||| | | | |Hpy166II |||| | | | |HindII |||| | | | |BbvI |||| | | | EcoP15I |||| | | BslFI |||| | BsiYI* |||| | Hpy99I |||| Cac8I |||CviJI |||TseI ||BisI |BbvI |BlsI |HgaI CviRI* M Q P A S G Q P G P S Q F A P P P P P P C S L R R V N Q V P H N L R L H L H L L A A C V G S T R S L T I C A S T S T S W ----:----|----:----|----:----|----:----|----:----|----:----| I C G A D P * G P G E C N A G G G G G G L A A Q T P D V L D R V I Q A E V E V E H L R R R T L W T G * L K R R W R W R R TspDTI | AsuI* | AvaII | DraII | PpuMI | |NlaIV | |BmgT120I HindIII | || TatI | AluI | || Bsp1407I | CviJI MseI TfiI | || |Csp6I | |HphI MnlI HinfI | || ||RsaI BsrI | ||SetI \ \ \ \\ \\\ \ \ \\\ GGCGTTAATGTGAATATGAATCAAATGCCAATGGGTCCTGTACAAGTTCCAGTTCAAGCT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CCGCAATTACACTTATACTTAGTTTACGGTTACCCAGGACATGTTCAAGGTCAAGTTCGA / / / / / /// /// / / / / | | MseI HinfI | ||| ||| BsrI | | HindIII | MnlI TfiI | ||| ||Bsp1407I | CviJI EcoRII | ||| ||TatI | AluI BssKI | ||| |Csp6I | HphI | ||| RsaI SetI | ||PpuMI | ||DraII | ||AvaII | ||AsuI* | |BmgT120I | NlaIV TspDTI G V N V N M N Q M P M G P V Q V P V Q A A L M * I * I K C Q W V L Y K F Q F K L R * C E Y E S N A N G S C T S S S S S F ----:----|----:----|----:----|----:----|----:----|----:----| P T L T F I F * I G I P G T C T G T * A Q R * H S Y S D F A L P D Q V L E L E L A N I H I H I L H W H T R Y L N W N L S EcoNI |BssKI |EcoRII ||BsiYI* |||ScrFI |||BseBI |||| AsuI* |||| DraII |||| |CviJI |||| |HaeIII |||| |Hin4II* |||| |BmgT120I Hin4II* |||| || AlwNI | MslI |||| || | MmeI | | TstI |||| || | |BsaXI | | BsaXI |||| || | ||BsiYI* | | |BccI |||| || | |||TstI | | ||GsuI |||| || | |||| Hin6I | | ||Eco57MI |||| || | |||| |GlaI | | ||| TaqII |||| || | |||| ||HhaI \ \ \\\ \ \\\\ \\ \ \\\\ \\\ TCGCCTTCACCCATCGGTATGTCCAACACTCCTTCTCCAGGCCCTGTGGTTGGCGCAACT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| AGCGGAAGTGGGTAGCCATACAGGTTGTGAGGAAGAGGTCCGGGACACCAACCGCGTTGA / // / / / / / ///// // /// | || | | TaqII | | ||||| |BsiYI* ||Hin6I | || | BccI | | ||||| BsaXI |GlaI | || Eco57MI | | ||||| MmeI HhaI | || GsuI | | ||||| TstI | |MslI | | ||||DraII | BsaXI | | ||||AsuI* Hin4II* | | |||BmgT120I TstI | | ||EcoRII | | ||HaeIII | | ||BssKI | | ||CviJI | | |Hin4II* | | |AlwNI | | BseBI | | ScrFI | EcoNI BsiYI* S P S P I G M S N T P S P G P V V G A T R L H P S V C P T L L L Q A L W L A Q L A F T H R Y V Q H S F S R P C G W R N * ----:----|----:----|----:----|----:----|----:----|----:----| E G E G M P I D L V G E G P G T T P A V K A K V W R Y T W C E K E L G Q P Q R L R R * G D T H G V S R R W A R H N A C S CviRI* | MnlI | | Hpy166II | | | MboI | | | Ksp632I* | | | | DpnI MboII | | | | |TaqI | SapI | | | | |BstKTI | Ksp632I* | | | | ||HgaI | | MwoI MaeII \ \ \ \ \\\ \ \ \ \ AAAATGCCTCTGCAAAGTGGACGCAGATCGAAGAGAGATTTGTCGCCTGAAGAGCAAAGA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTACGGAGACGTTTCACCTGCGTCTAGCTTCTCTCTAAACAGCGGACTTCTCGTTTCT / / / ///// / / // // | | | ||||| HgaI MboII |MwoI |MboII | | | ||||TaqI Ksp632I* TaiI | | | |||MboI SapI SetI | | | ||Ksp632I* | | | |DpnI | | | BstKTI | | Hpy166II | MnlI CviRI* K M P L Q S G R R S K R D L S P E E Q R K C L C K V D A D R R E I C R L K S K D N A S A K W T Q I E E R F V A * R A K T ----:----|----:----|----:----|----:----|----:----|----:----| L I G R C L P R L D F L S K D G S S C L * F A E A F H V C I S S L N T A Q L A F F H R Q L T S A S R L S I Q R R F L L S MboII | SetI | TaiI | | CviRI* | | | Eco57I BseRI | | | Eco57MI |MlyI | | | | FatI |PleI HinfI | | | |TfiI |CviAII Hpy178III* |SetI |BspCNI | | | |HinfI || NlaIII | DdeI ||MseI ||BseMII \ \ \ \\ \\ \ \ \ \\\ \\\ CGTTTGCAGATTCGTCATGCCAAAGTGGAGAAAATCTTGAAATACTCAGGTTTAATGACT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| GCAAACGTCTAAGCAGTACGGTTTCACCTCTTTTAGAACTTTATGAGTCCAAATTACTGA / / / / // / // // / // / | | | | |FatI | || || | || HinfI | | | | CviAII | || || | |BseMII | | | NlaIII | || || | BspCNI | | HinfI | || || MseI | | TfiI | || |PleI | Eco57MI | || MlyI | Eco57I | |BseRI | CviRI* | |DdeI MaeII | SetI Hpy178III* R L Q I R H A K V E K I L K Y S G L M T V C R F V M P K W R K S * N T Q V * * L F A D S S C Q S G E N L E I L R F N D S ----:----|----:----|----:----|----:----|----:----|----:----| R K C I R * A L T S F I K F Y E P K I V V N A S E D H W L P S F R S I S L N L S T Q L N T M G F H L F D Q F V * T * H S TspEI BsmAI BseMII |BspCNI || MnlI || MaeIII || Tsp45I || | DdeI || | | AsuI* || | | AvaII || | | DraII BsiI* || | | PpuMI | Hpy178III* || | | TspRI | | TspDTI || | | |BmgT120I | | | MnlI || | | ||NlaIV | | | |HphI EcoRV || | | ||| MnlI \ \ \ \\ \ \\ \ \ \\\ \ CCTCGTGATAAGGACTTCATCACCAGATATCAGTTGTCTCAAATTGTCACTGAGGACCCT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| GGAGCACTATTCCTGAAGTAGTGGTCTATAGTCAACAGAGTTTAACAGTGACTCCTGGGA / / // / // // / / // / | | |HphI EcoRV || || | | || MnlI | | MnlI || || | | |PpuMI | Hpy178III* || || | | |DraII | BsiI* || || | | |AvaII TspDTI || || | | |AsuI* || || | | BmgT120I || || | | NlaIV || || | DdeI || || Tsp45I || || MaeIII || |BsmAI || |TspEI || |TspRI || MnlI |BspCNI BseMII P R D K D F I T R Y Q L S Q I V T E D P L V I R T S S P D I S C L K L S L R T L S * * G L H H Q I S V V S N C H * G P L ----:----|----:----|----:----|----:----|----:----|----:----| G R S L S K M V L Y * N D * I T V S S G E E H Y P S * * W I D T T E F Q * Q P G R T I L V E D G S I L Q R L N D S L V R BssKI EcoRII | ScrFI | BseBI | | AccI MaeII | | SetI |BtrI | | |Hpy166II || SetI | | || Hin4I || TaiI | | || | MnlI AciI || | Hpy188I \ \ \\ \ \ \ \\ \ \ TACAATGAGGATTTCTACTTCCAGGTCTACAAGATTATCCAAAGAGGCGGTATCACGTCC 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTTACTCCTAAAGATGAAGGTCCAGATGTTCTAATAGGTTTCTCCGCCATAGTGCAGG // / // / / / / // / || | || Hin4I MnlI AciI | || Hpy188I || | |AccI | |MaeII || | Hpy166II | BtrI || EcoRII TaiI || BssKI SetI |BseBI |ScrFI SetI Y N E D F Y F Q V Y K I I Q R G G I T S T M R I S T S R S T R L S K E A V S R P Q * G F L L P G L Q D Y P K R R Y H V R ----:----|----:----|----:----|----:----|----:----|----:----| * L S S K * K W T * L I I W L P P I V D K C H P N R S G P R C S * G F L R Y * T V I L I E V E L D V L N D L S A T D R G Hpy178III* TfiI | MlyI HinfI Hin4I SetI MaeI MmeI Hin4I | PleI HinfI DrdI \ \ \ \ \ \ \ \ \ \ GAATCCAACAAAGGTTTGATTGCTAGGGCGTATTTGGAACATTCTGGACACAGACTCGGT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAGGTTGTTTCCAAACTAACGATCCCGCATAAACCTTGTAAGACCTGTGTCTGAGCCA / / / / / / /// // | HinfI SetI | MmeI Hin4I ||PleI |DrdI | TfiI MaeI |MlyI HinfI Hin4I Hpy178III* E S N K G L I A R A Y L E H S G H R L G N P T K V * L L G R I W N I L D T D S V I Q Q R F D C * G V F G T F W T Q T R W ----:----|----:----|----:----|----:----|----:----|----:----| S D L L P K I A L A Y K S C E P C L S P R I W C L N S Q * P T N P V N Q V C V R F G V F T Q N S P R I Q F M R S V S E T TsoI CviJI CviRI* | MaeIII Hin4I SfeI* | BsmI | Tsp45I \ \ \ \ \ \ GGTCGCTATAAGAGAACCGATATTGCCCTACAGAGAATGCAAAGTCAAGTAGAAAAGGCT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CCAGCGATATTCTCTTGGCTATAACGGGATGTCTCTTACGTTTCAGTTCATCTTTTCCGA / / / / / / Hin4I SfeI* CviRI* | | TspRI BsmI | CviJI TsoI G R Y K R T D I A L Q R M Q S Q V E K A V A I R E P I L P Y R E C K V K * K R L S L * E N R Y C P T E N A K S S R K G C ----:----|----:----|----:----|----:----|----:----|----:----| P R * L L V S I A R C L I C L * T S F A H D S Y S F R Y Q G V S F A F D L L F P T A I L S G I N G * L S H L T L Y F L S EcoP15I | SetI | | DdeI | | |Hin4II* | | || Hin4II* | | || | BbvI | | || | MboI | | || | | DpnI | | || | | |BstKTI | | || | | || BinI* | | || | | || | AciI | | || | | || | |BisI | | || | | || | ||BlsI | | || | | || | |||TseI Tsp4CI* | | || | | || | |||TauI | TspRI | | || | | || | |||CviJI | |CviJI | | || | | || | ||||BisI | ||DdeI | | || | | || | |||||BlsI | ||Bpu10I | | || | | || | |||||| MaeIII \ \\\ \ \ \\ \ \ \\ \ \\\\\\ \ GTCACTGTGGCTAAGGAAAGACCTTCTAAGTTGAAGGATCAACAAGCGGCTGCTGGTAAC 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTGACACCGATTCCTTTCTGGAAGATTCAACTTCCTAGTTGTTCGCCGACGACCATTG / / / / / / / / // / //////// / | | | | | | | | || MboI |||||||TseI MaeIII | | | | | | | | || BbvI ||||||BisI | | | | | | | | |DpnI |||||BlsI | | | | | | | | BstKTI ||||CviJI | | | | | | | Hin4II* |||BisI | | | | | | DdeI |||AciI | | | | | Hin4II* ||BlsI | | | | EcoP15I |TauI | | | SetI BinI* | | Bpu10I | | DdeI | CviJI Tsp4CI* Tsp45I MaeIII V T V A K E R P S K L K D Q Q A A A G N S L W L R K D L L S * R I N K R L L V T H C G * G K T F * V E G S T S G C W * L ----:----|----:----|----:----|----:----|----:----|----:----| T V T A L S L G E L N F S * C A A A P L Q * Q P * P F V K * T S P D V L P Q Q Y D S H S L F S R R L Q L I L L R S S T V MaeI | BssKI | CviJI | EcoRII | | ScrFI TsoI | | BseBI |Cac8I Tsp4CI* MboII Ksp632I* \ \ \ \\ \ \ \ TCTAGCCAGGATAATAAGCAAGCAAACACGGTTCTGGGCAAAATCTCTTCCACTTTGAAC 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| AGATCGGTCCTATTATTCGTTCGTTTGTGCCAAGACCCGTTTTAGAGAAGGTGAAACTTG // / / / / / / / || | EcoRII | Cac8I Tsp4CI* MboII Ksp632I* || | BssKI TsoI || BseBI || ScrFI |CviJI MaeI S S Q D N K Q A N T V L G K I S S T L N L A R I I S K Q T R F W A K S L P L * T * P G * * A S K H G S G Q N L F H F E Q ----:----|----:----|----:----|----:----|----:----|----:----| E L W S L L C A F V T R P L I E E V K F S * G P Y Y A L L C P E P C F R K W K S R A L I I L L C V R N Q A F D R G S Q V BinI* BbvII* |SfeI* || CviRI* CviJI || | MboI | SfaNI || | PstI | | Hpy188I || | XhoII | | | Hin4II* || | MboII | | | | Hin6I TfiI || | | DpnI | | | | |GlaI HinfI || | | |BstKTI | | | | ||HhaI \ \\ \ \ \\ \ \ \ \ \\\ AGCAAGAATCCAAGAAGACAACTGCAGATCCCCAGACAACAGCCTTCTGACCCCGATGCG 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TCGTTCTTAGGTTCTTCTGTTGACGTCTAGGGGTCTGTTGTCGGAAGACTGGGGCTACGC / / ///// / / / / / /// HinfI | ||||| XhoII | | | | ||Hin6I TfiI | ||||| MboI | | | | |GlaI | ||||DpnI | | | | HhaI | |||BstKTI | | | Hin4II* | ||SfeI* | | SfaNI | |BbvII* | Hpy188I | |MboII CviJI | CviRI* BinI* PstI S K N P R R Q L Q I P R Q Q P S D P D A A R I Q E D N C R S P D N S L L T P M R Q E S K K T T A D P Q T T A F * P R C A ----:----|----:----|----:----|----:----|----:----|----:----| L L F G L L C S C I G L C C G E S G S A C C S D L F V V A S G W V V A K Q G R H A L I W S S L Q L D G S L L R R V G I R AcyI MaeII |ZraI |MaeIII |Tsp45I ||MlyI ||PleI |||SetI |||TaiI |||AatII |||| HinfI |||| | TspRI |||| | | Hpy188I |||| | | | Hin4I |||| | | | | MaeII |||| | | | | Eco57I |||| | | | | Eco57MI |||| | | | | | SetI |||| | | | | | TaiI |||| | | | | | |XcmI |||| | | | | | |Hpy166II |||| | | | | | || MboII |||| | | | | | || | CviJI |||| | | | | | || | HaeIII |||| | | | | | || | | BseRI |||| | | | | | || | | | BsiYI* |||| | | | | | || | | | |Ksp632I* |||| | | | | | || | | | ||EcoP15I |||| | | | | | || | | | |||AsuI* |||| | | | | | || | | | |||AvaII |||| | | | | | || | | | |||DraII |||| | | | | | || | | | |||PpuMI |||| | | | | | || | | | ||||MnlI |||| | | | | | || | | | ||||NlaIV |||| | | | | | || | | | ||||BmgT120I |||| | | | | | || | | | ||||| Hin4I |||| | | | | | || | | | ||||| | MboII \\\\ \ \ \ \ \ \\ \ \ \ \\\\\ \ \ CTAAAAGACGTCACTGACTCTCTGACCAACGTGGACTTGGCCTCTTCAGGGTCCTCCTCT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| GATTTTCTGCAGTGACTGAGAGACTGGTTGCACCTGAACCGGAGAAGTCCCAGGAGGAGA / /// / // / // //// / // //// / | ||| | || | || |||MboII | || |||| MboII | ||| | || | || ||| | || |||PpuMI | ||| | || | || ||| | || |||DraII | ||| | || | || ||| | || |||AvaII | ||| | || | || ||| | || |||AsuI* | ||| | || | || ||| | || ||BmgT120I | ||| | || | || ||| | || ||Hin4I | ||| | || | || ||| | || |Ksp632I* | ||| | || | || ||| | || |EcoP15I | ||| | || | || ||| | || |NlaIV | ||| | || | || ||| | || MnlI | ||| | || | || ||| | |BsiYI* | ||| | || | || ||| | BseRI | ||| | || | || ||| HaeIII | ||| | || | || ||| CviJI | ||| | || | || ||Hpy166II | ||| | || | || |XcmI | ||| | || | || MaeII | ||| | || | |TaiI | ||| | || | |SetI | ||| | || | Eco57MI | ||| | || | Eco57I | ||| | || Hpy188I | ||| | |Hin4I | ||| | HinfI | ||| Tsp45I | ||| MaeIII | ||PleI | |MaeII | |AcyI | |MlyI | TspRI | ZraI AatII TaiI SetI L K D V T D S L T N V D L A S S G S S S * K T S L T L * P T W T W P L Q G P P L K R R H * L S D Q R G L G L F R V L L Y ----:----|----:----|----:----|----:----|----:----|----:----| S F S T V S E R V L T S K A E E P D E E A L L R * Q S E S W R P S P R K L T R R * F V D S V R Q G V H V Q G R * P G G R BbvI MnlI | CviJI | |MnlI | ||SduI MboII | ||HgiJII* TspDTI | ||| SapI | MboI | ||| Ksp632I* | BglII | ||| | AciI | XhoII | ||| | BisI | | DpnI | ||| | |BlsI | | XmnI | ||| | ||TseI | | |BstKTI | ||| | ||TauI | | || MboII | ||| | ||NspBII* | | || | MluI | ||| | |||BisI DdeI | | || | MboII | ||| | ||||BlsI |FalI | | || | AflIII | ||| | ||||| MwoI |FalI | | || | | FnuDII* \ \\\ \ \\\\\ \ \\ \ \ \\ \ \ \ ACGGGCTCTTCTGCCGCTGCTGTTGCTTCTAAGCAAAGAAGAAGATCTTCATACGCGTTC 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TGCCCGAGAAGACGGCGACGACAACGAAGATTCGTTTCTTCTTCTAGAAGTATGCGCAAG // / / /////// / / // // / / / / / || | BbvI ||||||MwoI FalI | |MboII || | | | | AflIII || CviJI ||||||TseI FalI | TspDTI || | | | | FalI || MnlI |||||BisI DdeI || | | | | FalI |HgiJII* ||||BlsI || | | | | MluI |SduI |||NspBII* || | | | FnuDII* MnlI |||AciI || | | MboII ||Ksp632I* || | MboII ||SapI || XhoII ||BisI || BglII |BlsI || MboI TauI |XmnI |DpnI BstKTI T G S S A A A V A S K Q R R R S S Y A F R A L L P L L L L L S K E E D L H T R S G L F C R C C C F * A K K K I F I R V Q ----:----|----:----|----:----|----:----|----:----|----:----| V P E E A A A T A E L C L L L D E Y A N * P S K Q R Q Q Q K * A F F F I K M R T R A R R G S S N S R L L S S S R * V R E Tsp4CI* FalI | HgiCI* ApoI ApoI SmlI FalI | | NlaIV TspEI TspDTI TspEI Hpy178III* \ \ \ \ \ \ \ \ AACAACGGTAATGGTGCCACAAATTTGAACAAATCTGGGGGCAAAAAATTCATTCTTGAG 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTTGCCATTACCACGGTGTTTAAACTTGTTTAGACCCCCGTTTTTTAAGTAAGAACTC / / / / / / / / Tsp4CI* | HgiCI* TspEI TspDTI TspEI | SmlI NlaIV ApoI ApoI Hpy178III* N N G N G A T N L N K S G G K K F I L E T T V M V P Q I * T N L G A K N S F L S Q R * W C H K F E Q I W G Q K I H S * V ----:----|----:----|----:----|----:----|----:----|----:----| L L P L P A V F K F L D P P L F N M R S * C R Y H H W L N S C I Q P C F I * E Q V V T I T G C I Q V F R P A F F E N K L AluI CfrI CviJI | BalI Tsp4CI* |MnlI | CviJI MseI | Ksp632I* MboII ||SetI | HaeIII |TspEI | | Bce83I* |TspDTI ||| SmlI | | Cac8I \\ \ \ \ \\ \\\ \ \ \ \ TTAATTGAAACAGTTTATGAAGAGATTTTAGACTTGGAAGCTAACTTGAGGAATGGCCAG 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| AATTAACTTTGTCAAATACTTCTCTAAAATCTGAACCTTCGATTGAACTCCTTACCGGTC / / / / / / / / / / / | | | | Ksp632I* TspDTI | CviJI SmlI | Cac8I | | | Bce83I* MboII | AluI | CfrI | | Tsp4CI* | MnlI HaeIII | TspEI SetI CviJI MseI BalI L I E T V Y E E I L D L E A N L R N G Q * L K Q F M K R F * T W K L T * G M A S N * N S L * R D F R L G S * L E E W P A ----:----|----:----|----:----|----:----|----:----|----:----| N I S V T * S S I K S K S A L K L F P W T L Q F L K H L S K L S P L * S S S H G * N F C N I F L N * V Q F S V Q P I A L MslI CviRI* | MnlI | TspRI | | BsrDI TaqI | | | AsuI* TspDTI MaeII | | | DraII | Hin4II* |TspDTI | | | |CviJI | | Hpy99I || SetI Bce83I* | | | |HaeIII | | | Tsp4CI* || TaiI | BtsI | | | |BmgT120I | | | | NdeI || |Hpy166II \ \ \ \ \ \\ \ \ \ \ \ \\ \\ CAAACTGACAGCACTGCAATGTGGGAGGCCCTTCACATCGACGACAGTTCATATGACGTA 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTGACTGTCGTGACGTTACACCCTCCGGGAAGTGTAGCTGCTGTCAAGTATACTGCAT / / // / /// / /// / / / / / | TspRI || BsrDI ||DraII | ||TaqI Tsp4CI* | | | Hpy166II | BtsI |MnlI ||AsuI* | |Hin4II* | | MaeII Bce83I* CviRI* || | Hpy99I | TspDTI MslI || TspDTI | TaiI |BmgT120I | SetI HaeIII NdeI CviJI Q T D S T A M W E A L H I D D S S Y D V K L T A L Q C G R P F T S T T V H M T * N * Q H C N V G G P S H R R Q F I * R K ----:----|----:----|----:----|----:----|----:----|----:----| C V S L V A I H S A R * M S S L E Y S T A F Q C C Q L T P P G E C R R C N M H R L S V A S C H P L G K V D V V T * I V Y MaeI TaqI SetI | ApoI MseI SfaNI MslI | Hpy178III* | TspEI |TspEI \ \ \ \ \ \ \\ AACCCTTTCATTTCGATGCTATCATTTGATAAAGGTATCAAGATTATGCCTAGAATTTTT 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TTGGGAAAGTAAAGCTACGATAGTAAACTATTTCCATAGTTCTAATACGGATCTTAAAAA / / / / / / / | | TaqI SetI Hpy178III* MaeI TspEI | MslI ApoI SfaNI N P F I S M L S F D K G I K I M P R I F T L S F R C Y H L I K V S R L C L E F L P F H F D A I I * * R Y Q D Y A * N F * ----:----|----:----|----:----|----:----|----:----|----:----| F G K M E I S D N S L P I L I I G L I K L G K * K S A I M Q Y L Y * S * A * F K V R E N R H * * K I F T D L N H R S N K TseI |BisI TspEI MboII ||BlsI | BbvI CviRI* TspEI \\\ \ \ \ \ AATTTCTTGGATAAGCAGCAAAAATTGAAAATCCTGCAAAAAATCTTCAATGAATTATCA 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAAGAACCTATTCGTCGTTTTTAACTTTTAGGACGTTTTTTAGAAGTTACTTAATAGT / / /// / / // / | TspEI ||TseI | | |CviRI* TspEI MseI |BisI | | MboII BlsI | BbvI TspEI N F L D K Q Q K L K I L Q K I F N E L S I S W I S S K N * K S C K K S S M N Y H F L G * A A K I E N P A K N L Q * I I T ----:----|----:----|----:----|----:----|----:----|----:----| L K K S L C C F N F I R C F I K L S N D * N R P Y A A F I S F G A F F R * H I I I E Q I L L L F Q F D Q L F D E I F * * TspDTI MfeI |CviRI* TspEI \\ \ CACTTGCAAATCATCATATTGAGTTCCTACAAGACTACACCAAAACCAACTTTGACACAA 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| GTGAACGTTTAGTAGTATAACTCAAGGATGTTCTGATGTGGTTTTGGTTGAAACTGTGTT / / | CviRI* TspDTI H L Q I I I L S S Y K T T P K P T L T Q T C K S S Y * V P T R L H Q N Q L * H N L A N H H I E F L Q D Y T K T N F D T I ----:----|----:----|----:----|----:----|----:----|----:----| C K C I M M N L E * L V V G F G V K V C V S A F * * I S N R C S * V L V L K S V V Q L D D Y Q T G V L S C W F W S Q C L MboI BclI | DpnI TaqI | |BstKTI |MboI | || MseI || DpnI | || | MboI || |MboII | || | | DpnI || |BstKTI | || | | |BstKTI BsmAI \\ \\ \ \\ \ \ \\ \ TTGAAGAAAGTCGATCTGTTCCAAATGATCATATTAAAGATCATTGTCTCGTTTTTGTCT 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTCTTTCAGCTAGACAAGGTTTACTAGTATAATTTCTAGTAACAGAGCAAAAACAGA / // / // / / // / / TspEI || MboI || BclI | || MboI BsmAI MfeI |MboII || MboI | |DpnI |DpnI |DpnI | BstKTI BstKTI BstKTI MseI TaqI L K K V D L F Q M I I L K I I V S F L S * R K S I C S K * S Y * R S L S R F C L E E S R S V P N D H I K D H C L V F V * ----:----|----:----|----:----|----:----|----:----|----:----| N F F T S R N W I I M N F I M T E N K D I S S L R D T G F S * I L S * Q R T K T Q L F D I Q E L H D Y * L D N D R K Q R SfeI* TaqI | Tsp4CI* AclI TspEI | TspEI | | MseI Hpy188I MaeII \ \ \ \ \ \ \ \ AATAACTCCAATTTTATCGAAATTATGGGTCTGTTGCTACAGTTAATCAGAAACAACAAC 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTGAGGTTAAAATAGCTTTAATACCCAGACAACGATGTCAATTAGTCTTTGTTGTTG / / / // / / / TspEI TaqI TspEI || | Hpy188I TaiI || MseI SetI |SfeI* Tsp4CI* N N S N F I E I M G L L L Q L I R N N N I T P I L S K L W V C C Y S * S E T T T * L Q F Y R N Y G S V A T V N Q K Q Q R ----:----|----:----|----:----|----:----|----:----|----:----| L L E L K I S I I P R N S C N I L F L L * Y S W N * R F * P D T A V T L * F C C I V G I K D F N H T Q Q * L * D S V V V HphI ApoI TspEI Hpy178III* | MboI | SetI | BclI SetI | | TspEI | | DpnI TaiI | | | MnlI | | |BstKTI BsiI* \ \ \ \ \ \ \ \\ \ GTTTCGTTCTTGACCACCTCCAAAATTGGTCTAAATTTGATCACCATTTTGATTTCTCGT 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| CAAAGCAAGAACTGGTGGAGGTTTTAACCAGATTTAAACTAGTGGTAAAACTAAAGAGCA / / / // / / // / / MaeII | SetI || HphI | || BclI BsiI* AclI Hpy178III* |TspEI | || MboI MnlI | |DpnI | BstKTI TspEI ApoI V S F L T T S K I G L N L I T I L I S R F R S * P P P K L V * I * S P F * F L V F V L D H L Q N W S K F D H H F D F S C ----:----|----:----|----:----|----:----|----:----|----:----| T E N K V V E L I P R F K I V M K I E R R K T R S W R W F Q D L N S * W K S K E N R E Q G G G F N T * I Q D G N Q N R T AciI Hpy178III* BisI | MboI |BlsI | BglII ||TauI | XhoII ||| MseI | | DpnI ||| VspI TfiI | | |BstKTI Hpy178III* ||| | TspDTI HinfI | | || SspI | MnlI \\\ \ \ \ \ \ \\ \ \ \ GCCGCATTAATCAAGCAAGATTCATCAAGATCTAATATTCTTTCCTCTCCTGAAATCTCC 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| CGGCGTAATTAGTTCGTTCTAAGTAGTTCTAGATTATAAGAAAGGAGAGGACTTTAGAGG //// / / /// / / / / |||AciI TspDTI HinfI ||| | SspI | MnlI ||BisI VspI TfiI ||| XhoII Hpy178III* |BlsI MseI ||| BglII TauI ||| MboI ||DpnI |BstKTI Hpy178III* A A L I K Q D S S R S N I L S S P E I S P H * S S K I H Q D L I F F P L L K S P R I N Q A R F I K I * Y S F L S * N L H ----:----|----:----|----:----|----:----|----:----|----:----| A A N I L C S E D L D L I R E E G S I E H R M L * A L N M L I * Y E K R E Q F R G C * D L L I * * S R I N K G R R F D G AluI CviJI FatI TfiI PvuII |CviAII TspEI Hin4I NspBII* || NlaIII |TspDTI HinfI | SetI \\ \ \\ \ \ \ ACATGGAATGAGATTTATGATAAATTATTCACTTCATTGGAAAGTAAGATTCAGCTGATT 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| TGTACCTTACTCTAAATACTATTTAATAAGTGAAGTAACCTTTCATTCTAAGTCGACTAA / // / / / // / | |FatI | TspEI Hin4I || NspBII* | CviAII TspDTI || PvuII NlaIII || CviJI || AluI |SetI HinfI TfiI T W N E I Y D K L F T S L E S K I Q L I H G M R F M I N Y S L H W K V R F S * F M E * D L * * I I H F I G K * D S A D F ----:----|----:----|----:----|----:----|----:----|----:----| V H F S I * S L N N V E N S L L I * S I W M S H S K H Y I I * K M P F Y S E A S C P I L N I I F * E S * Q F T L N L Q N StyI FatI SecI* |CviAII | BsiYI* || NlaIII | | MnlI Hin4I || | Hpy166II \ \ \ \ \\ \ \ TTCCCTCCAAGGGAATATAACGACCACATCATGCGTTTACAAAATGACAAGTTTATGGAT 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| AAGGGAGGTTCCCTTATATTGCTGGTGTAGTACGCAAATGTTTTACTGTTCAAATACCTA / / / / / // / | | | Hin4I | || Hpy166II | | MnlI | |FatI | SecI* | CviAII | StyI NlaIII BsiYI* F P P R E Y N D H I M R L Q N D K F M D S L Q G N I T T T S C V Y K M T S L W M P S K G I * R P H H A F T K * Q V Y G * ----:----|----:----|----:----|----:----|----:----|----:----| K G G L S Y L S W M M R K C F S L N I S K G E L P I Y R G C * A N V F H C T * P E R W P F I V V V D H T * L I V L K H I MaeI | AluI | CviJI | |MaeI AluI FokI | ||SetI DdeI CviJI BseGI | TspDTI | ||| MwoI | DraIII | SetI \ \ \ \ \\\ \ \ \ \ \ GAAGCATACATTTGGCAGTTCCTAGCTAGTTTAGCACTAAGTGGAAAGCTAAACCACCAG 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCGTATGTAAACCGTCAAGGATCGATCAAATCGTGATTCACCTTTCGATTTGGTGGTC / / / /// / / / / / BseGI | FokI ||| MwoI | DdeI | CviJI TspDTI ||| MaeI DraIII | AluI ||CviJI SetI ||AluI |MaeI SetI E A Y I W Q F L A S L A L S G K L N H Q K H T F G S S * L V * H * V E S * T T R S I H L A V P S * F S T K W K A K P P E ----:----|----:----|----:----|----:----|----:----|----:----| S A Y M Q C N R A L K A S L P F S F W W H L M C K A T G L * N L V L H F A L G G F C V N P L E * S T * C * T S L * V V L Csp6I |RsaI ||MaeII |||BsaAI TspDTI BsmAI TfiI |||| SetI |MnlI Eco31I HinfI |||| TaiI TspDTI || MseI | AciI \ \\\\ \ \ \\ \ \ \ AGAATCATTATTGATGAAGTACGTGATGAAATCTTTGCCACTATTAACGAGGCGGAGACC 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTAGTAATAACTACTTCATGCACTACTTTAGAAACGGTGATAATTGCTCCGCCTCTGG / //// / / / / // / HinfI |||| TspDTI | MnlI MseI || SetI TfiI |||MaeII TspDTI |AciI ||BsaAI Eco31I |Csp6I BsmAI RsaI TaiI SetI R I I I D E V R D E I F A T I N E A E T E S L L M K Y V M K S L P L L T R R R P N H Y * * S T * * N L C H Y * R G G D L ----:----|----:----|----:----|----:----|----:----|----:----| L I M I S S T R S S I K A V I L S A S V S F * * Q H L V H H F R Q W * * R P P S S D N N I F Y T I F D K G S N V L R L G Bce83I* | MnlI | | DdeI | | |SetI | | || Hpy188I | | || | SetI | | || | |SmlI | | || | |MnlI | | || | || Hpy178III* | | || | || |BsmAI | | || | || |Eco31I | | || | || ||BspCNI | | || | || |||TspEI | | || | || |||BseMII SetI EciI TspEI | | || | || |||| Hin4I \ \ \ \ \ \\ \ \\ \\\\ \ TTACAAAAGAAAGAGAAAGAATTGAGTGTATTACCTCAGAGGTCTCAAGAATTAGACACA 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| AATGTTTTCTTTCTCTTTCTTAACTCACATAATGGAGTCTCCAGAGTTCTTAATCTGTGT / / / // /// / /// / / EciI | | |SetI ||| | ||| | TspEI | | MnlI ||| | ||| Eco31I | Bce83I* ||| | ||| BsmAI TspEI ||| | ||Hpy178III* ||| | ||SmlI ||| | |BseMII ||| | |Hin4I ||| | BspCNI ||| MnlI ||SetI |DdeI Hpy188I L Q K K E K E L S V L P Q R S Q E L D T Y K R K R K N * V Y Y L R G L K N * T Q T K E R E R I E C I T S E V S R I R H R ----:----|----:----|----:----|----:----|----:----|----:----| K C F F S F S N L T N G * L D * S N S V R V F S L S L I S H I V E S T E L I L C * L L F L F F Q T Y * R L P R L F * V C ApoI PsiI TspEI MseI | Hin4I | XmnI \ \ \ \ \ GAGTTAAAATCTATTATTTATAATAAAGAGAAACTATACCAAGATTTGAATTTGTTCCTA 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| CTCAATTTTAGATAATAAATATTATTTCTCTTTGATATGGTTCTAAACTTAAACAAGGAT / // / MseI |PsiI TspEI Hin4I XmnI ApoI E L K S I I Y N K E K L Y Q D L N L F L S * N L L F I I K R N Y T K I * I C S * V K I Y Y L * * R E T I P R F E F V P K ----:----|----:----|----:----|----:----|----:----|----:----| S N F D I I * L L S F S Y W S K F K N R L T L I * * K Y Y L S V I G L N S N T G L * F R N N I I F L F * V L I Q I Q E * AclI BccI MaeII | Hpy178III* BtgZI | SetI | |NruI |Hpy188I | TaiI | |FnuDII* ||HphI \ \ \ \\ \\\ AACGTTATGGGGTTGGTGTATCGCGATGGTGAAATATCAGAACTAAAGTAA 2350 2360 2370 2380 2390 ----:----|----:----|----:----|----:----|----:----|- TTGCAATACCCCAACCACATAGCGCTACCACTTTATAGTCTTGATTTCATT / / / // // / | MaeII | |Hpy178III* || BtgZI | AclI | FnuDII* |HphI TaiI | NruI Hpy188I SetI BccI N V M G L V Y R D G E I S E L K * T L W G W C I A M V K Y Q N * S X R Y G V G V S R W * N I R T K V X ----:----|----:----|----:----|----:----|----:----|- F T I P N T Y R S P S I D S S F Y L R * P T P T D R H H F I L V L T V N H P Q H I A I T F Y * F * L L # Enzymes that cut Frequency Isoschizomers AatII 1 Acc65I 1 Asp718I AccI 2 FblI,XmiI AciI 12 BspACI,SsiI AclI 2 Psp1406I AcyI 3 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 1 AluI 6 AluBI AlwNI 2 CaiI ApoI 6 AcsI,XapI AsuI* 12 Cfr13I,PspPI,Sau96I,AspS9I AvaII 8 Bme18I,Eco47I,SinI,VpaK11BI AvrII 1 AspA2I,BlnI,XmaJI BalI 1 MlsI,MluNI,MscI,Msp20I BbvCI 1 BbvI 13 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 4 Bce83I* 4 BpuEI BceAI 2 BclI 2 FbaI,Ksp22I BdaI 2 BglII 2 BinI* 2 AlwI,BspPI,AclWI BisI 19 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 19 BmgT120I 12 Bpu10I 2 BsaAI 1 BstBAI,Ppu21I BsaXI 3 BseBI 5 Bst2UI,BstNI,BstOI,MvaI BseGI 3 BstF5I,BtsCI BseMII 4 BseRI 3 BsgI 1 BsiI* 2 BssSI,Bst2BI,BauI BsiYI* 8 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 5 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI Bsp1407I 1 BsrGI,BstAUI BspCNI 4 BsrDI 2 BseMI,Bse3DI BsrI 1 BseNI,Bse1I,BsrSI BssKI 5 BstSCI,StyD4I BstAPI 1 BstKTI 10 BtgZI 1 BtrI 1 BmgBI,AjiI BtsI 1 Cac8I 4 BstC8I CfrI 1 AcoI,EaeI Csp6I 4 CviQI,RsaNI CviAII 4 CviJI 25 CviKI-1 CviRI* 13 HpyCH4V DdeI 8 BstDEI,HpyF3I DinI 1 EgeI,EheI,SfoI DpnI 10 MalI DraII 7 EcoO109I DraIII 1 AdeI DrdI 2 AasI,DseDI DsaI* 2 BtgI,BstDSI EciI 2 Eco31I 3 Bso31I,BspTNI,BsaI Eco57I 3 AcuI Eco57MI 5 EcoNI 1 BstENI,XagI EcoP15I 7 EcoRII 5 AjnI,Psp6I,PspGI EcoRV 1 Eco32I FalI 2 FatI 4 FauI 1 SmuI FnuDII* 3 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 3 GlaI 5 GsuI 2 BpmI HaeII 1 BstH2I HaeIII 6 BsnI,BsuRI,BshFI,PhoI HgaI 3 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 4 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 5 BstHHI,CfoI,AspLEI Hin4I 5 Hin4II* 9 HpyAV Hin6I 5 HinP1I,HspAI HindII 1 HincII HindIII 1 HinfI 11 HpaII 1 HapII,BsiSI,MspI HphI 6 AsuHPI Hpy166II 7 Hpy8I Hpy178III* 12 Hpy188III Hpy188I 6 Hpy99I 4 KasI 1 KpnI 1 Ksp632I* 7 Eam1104I,EarI,Bst6I MaeI 8 FspBI,BfaI,XspI MaeII 9 HpyCH4IV MaeIII 5 MboI 10 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 13 MfeI 2 MunI MluI 1 MlyI 3 SchI MmeI 2 MnlI 26 MseI 9 Tru1I,Tru9I MslI 3 RseI,SmiMI MwoI 8 HpyF10VI,BstMWI NarI 1 Mly113I NcoI 1 Bsp19I NdeI 2 FauNDI NlaIII 4 Hin1II,Hsp92II,FaeI NlaIV 12 BspLI,BmiI,PspN4I NruI 1 BtuMI,Bsp68I NspBII* 4 MspA1I PflMI 2 BasI,AccB7I,Van91I PleI 3 PpsI PpuMI 5 Psp5II,PspPPI PsiI 1 AanI PstI 2 PvuII 1 RsaI 4 AfaI SapI 2 LguI,PciSI,BspQI ScrFI 5 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 4 BseDI,BssECI,BsaJI SetI 31 SexAI 1 MabI SfaNI 3 LweI SfeI* 5 BstSFI,SfcI,BfmI SmlI 4 SmoI SspI 1 StyI 3 Eco130I,EcoT14I,ErhI,BssT1I TaiI 9 TaqI 6 TaqII 2 TatI 2 TauI 6 TfiI 8 PfeI TseI 13 ApeKI TsoI 2 Tsp45I 3 NmuCI Tsp4CI* 7 HpyCH4III,TaaI,Bst4CI TspDTI 14 TspEI 22 TasI,Tsp509I,Sse9I TspRI 4 TscAI TstI 3 VspI 1 PshBI,AseI XbaI 1 XcmI 1 XhoII 3 BstYI,MflI,PsuI,BstX2I XmnI 2 MroXI,PdmI,Asp700I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AbsI AflII AgeI AhaIII* AjuI AlfI AloI ApaI ApaLI AscI AsuII AvaI BaeI BamHI BarI BcgI BciVI BetI* BfiI BglI BmeT110I BmtI BplI BsaBI BsePI BseSI BseYI Bsp120I BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BssNAI Bst1107I BstEII BstXI BstZ17I CauII* Cfr10I Cfr9I ClaI CspCI Eam1105I Ecl136II Eco47III EcoICRI EcoRI EcoT22I Esp3I EspI* FseI FspAI GsaI HpaI MauBI McrI* Mph1103I MroNI MstI* NaeI NgoMIV NheI NmeAIII NotI NsiI NspI OliI PacI PasI PfoI PmaCI PmeI PpiI PshAI PspOMI PspXI PsrI PvuI RsrII SacI SacII SalI SanDI SauI* ScaI SfiI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TspGWI TspMI Tth111I XhoI XmaCI XmaI XmaIII* Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769